Skip to main content
Have a personal or library account? Click to login
Enhancing hydatid cysts diagnosis utilizing cell-free DNA as a sensitive biomarker for Echinococcus spp. Cover

Enhancing hydatid cysts diagnosis utilizing cell-free DNA as a sensitive biomarker for Echinococcus spp.

Open Access
|Jun 2026

Figures & Tables

Fig. 1.

Viability of protoscolices using eosin stain (0.1 %), where stained is dead and unstained is live (blue arrow).

Fig. 2.

Casoni test with a hypersensitivity reaction (erythematous spot) on the upper left hand.

Fig. 3.

Cyst of hyadits in the viscera of the autopsied rats (A & B images).

Fig. 4.

Gel electrophoresis showing the amplicon of the nd1 gene of Echinococcus granulosus from protoscolices samples. The DNA marker (M) is a 50-1500 bp ladder, and the six samples show a distinct 674 bp band.

Fig. 5.

Gel electrophoresis showing the amplicon band of the nd1 gene of E. granulosus from the plasma samples; The DNA marker is a 50 to 1500 bp ladder, and the band size of sixteen samples is displayed as a distinct band at 674 bp.

Fig. 6.

Gel electrophoresis showing the amplicon of the nd1 of E. granulosus from serum samples. The DNA marker (M) is a 50-1500 bp ladder, and only one sample (R1) displayed a distinct band at 674 bp. Other uncleared bands with lengths less than 500 bp may belong to DNA random fragments of Echinococcus in the bloodstream that are not specifically targeted.

Fig. 7.

Evolutionary relationships of partial ND1 gene sequences from four isolates (sequenced; only one (SZ02) is recorded in the Gene Bank) belong to E. granulosus.

Target gene and primer sets used for the detection of Echinococcus spp_

Echinococcus spp.Target genePrimer5’-3’PCR ProductReference
Echinococcus granulosusnd1ND1-FTGTTGCAGAGGTTTGCTGAT674 bpUGene lab
ND1-RACGAACACGTGGTAATGTCG
Echinococcus multilocularisnd1EMND1-1FTTGTTCTTTGTGTTACTGTAGG457 bpShang et al. (2019)
EMND1-1RCTATACAGACATTGATTACCATAA
Echinococcus equinusnd2EEQND2-2FCGTTAATTCACTGATACATTGTATCC551 bpUGene lab
EEQND2-1RCTCACACCAAGCACCTACAC
DOI: https://doi.org/10.2478/helm-2026-0007 | Journal eISSN: 1336-9083 | Journal ISSN: 0440-6605
Language: English
Page range: 61 - 71
Submitted on: Aug 1, 2025
Accepted on: Mar 10, 2026
Published on: Jun 15, 2026
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2026 S. F. SHABAN, S. A. AL-AZIZZ, M. F. ABDULHAMEED, F. H. AHMED, published by Slovak Academy of Sciences, Institute of Parasitology
This work is licensed under the Creative Commons Attribution 4.0 License.