Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

Illustrated Accession number recorded by NCBI GenBank in human and explain identified percentage with another accession number, (the accessions obtained in the present study and submitted to the Gene Bank are indicated in bold)_
| Species | Accession No. | Region | Explain Identified % |
|---|---|---|---|
| E. granulosus | PV775780 | Khanke | Only PV775780 appeared similarity in NCBI with another accession no. 97%. |
| E. granulosus | PV952756 | Sinjar | |
| E. granulosus | PV972835 | Sinjar | |
| E. granulosus | MW881257 | Turkey | |
| E. granulosus | MG672257 | Kazakhstan | |
| E. granulosus | PV589303 | Sulaymaniyah | |
| E. granulosus | PV628705 | Zakho | |
| E. granulosus | MW599303 | Duhok | |
| E. granulosus | PV628704 | Zakho |
Distribution of hydatid cysts by host, organ, and cyst type, showing predominance of liver involvement and fertile cysts in both sheep and human samples_
| Host | Sex | Organ | Fertile | Infertile | Calcified | Total |
|---|---|---|---|---|---|---|
| Animal | ||||||
| Sheep | Female | Liver | 13 | 6 | - | 19 |
| Sheep | Male | Liver | 11 | 2 | - | 13 |
| Sheep | Female | Lung | 4 | 1 | - | 5 |
| Sheep | Male | Lung | 3 | - | - | 3 |
| Sheep | Female | Kidney | - | - | 1 | 1 |
| Human | ||||||
| Human | Female | Liver | 7 | - | 1 | 8 |
| Human | Male | Liver | 6 | 1 | 1 | 8 |
| Human | Male | Spleen | 1 | - | - | 1 |
Illustrated Accession number recorded by NCBI GenBank in sheep and explain the identified percentage with another accession number (the accessions obtained in the present study and submitted to the Gene Bank are indicated in bold)_
| Species | Accession no. | Isolated region | Similarity% |
|---|---|---|---|
| E. granulosus | PV764748 | Duhok | ------------ |
| E. granulosus | PV769900 | Duhok | ------------ |
| E. granulosus | PV826152 | Zakho | ------------ |
| E. granulosus | PV826155 | Zakho | ------------ |
| E. granulosus | PV799411 | Duhok | ------------ |
| E. granulosus | PV826146 | Duhok | ------------ |
| E. granulosus | PV941034 | Zakho | ------------ |
| E. granulosus | PV944412 | Zakho | ------------ |
| E. granulosus | PV947963 | Zakho | ------------ |
| E. granulosus | PV972833 | Duhok | ------------ |
| E. granulosus | PV540710 | Duhok | 100% |
| E. granulosus | OL655431 | Thi-qar | 100% |
| E. granulosus | OK067814 | Iraq | 100% |
| E. granulosus | PV589292 | Sulaymaniyah | 100% |
| E. granulosus | PQ778802 | Zakho | 100% |
| E. granulosus | MW599304 | Zakho | 98% |
| E. granulosus | MW674790 | Iran | 98% |
The designed species-specific primers of the Mt-COI gene for E_ granulosus
| Primer | Sequence (5'->3') | No. of nucleotides | Size gene product |
|---|---|---|---|
| Mt-COI SH | GCAGGGTTTGGGGTCATCAT | 20 | 213bp |
| Mt-COI LU | CCGTAACTCCCCCAAACGTA |