Skip to main content
Have a personal or library account? Click to login
Immunomodulatory effects of Terfezia claveryi extract against experimental Hysterothylacium thalassini infection in mice Cover

Immunomodulatory effects of Terfezia claveryi extract against experimental Hysterothylacium thalassini infection in mice

Open Access
|Dec 2025

Figures & Tables

Fig. 1.

(A and B) Third-stage larvae (white arrow) for the nematode parasite, H. thalassini, in the peritoneal cavity of S. tumbil.

Fig. 2.

Changes in the spleen index of the spleen of uninfected, infected with fresh, thermally, and frozen L3 larvae, as well as in infected groups administered TCE (250 mg/kg).* denotes a statistically significant difference relative to the control group; # denotes a statistically significant difference relative to the infected group.** Ratio of spleen weight in mg/mouse to body weight in g/mouse.

Fig. 3.

Immunohistochemical detection of caspase-3 in the spleen of mice. (A) control group. (B) Terfezia claveryi extract (TCE)-treated group. (C–E) infected groups with fresh, thermally, and frozen L3, respectively. (F–H) infected-treated groups with TCE (250 mg/kg) after inoculation with fresh, thermally, and frozen L3, respectively. Scale bar = 50 μm.

Fig. 4.

Effect of TCE on the mRNA expression of Caspase-3 in the spleen samples from L3-infected mice. The RT-PCR expression values were normalized to the reference gene β-actin and expressed as fold induction (log2 scale) relative to the control.* denotes a statistically significant difference relative to the control group; # denotes a statistically significant difference relative to the infected group.

Fig. 5.

Caspase-3 level in the spleen samples from the different experimental mouse groups.* denotes a statistically significant difference relative to the control group; # denotes a statistically significant difference relative to the infected group.

Phytochemical composition and antioxidant activity of Terfezia claveryi extract (TCE), including FRAP, DPPH, and ABTS assays_

PhytochemicalFRAP (μmol/g)DPPH (%)ABTS (μmol/g)
Qualitative+++++++++
Quantitative87.15 ± 2.3476.21 ± 1.3797.20 ± 0.27

Oligonucleotide primer sequences for reverse transcription PCR amplification in the experiment_

RNA targetDirectionOligonucleotide sequence (5′–3′)NCBI reference
Caspase-3ForwardCTAGCAGGATCCAGCAGTCCNM_009810
ReverseCCCCTATTCCACCCAACTTT

β-actinForwardGCTACAGCTTCACCACCACANM_007393
ReverseAAGGAAGGCTGGAAAAGAGC

TCE caused changes in hematological parameters of mice's blood after L3 infection_

Experimental mouse groupsRed blood cells (×106/l)Hemoglobin(g/dl)Hematocrit (%)Platelets (×103/L)White blood cells (×103/L)
Control10.34 ± 0.8613.24 ± 0.6147.06 ± 5.32328.67 ± 24.685.56 ± 0.64

TCE10.49 ± 0.9013.22 ± 0.5146.57 ± 4.37345.67 ± 11.675.35 ± 0.72

InfectedFresh L37.79 ± 0.27*8.86 ± 0.35*31.10 ± 1.15*858.33 ± 31.13*19.63 ± 1.01*
Thermal L38.78 ± 0.34*9.76 ± 0.35*36.90 ± 1.80*613.33 ± 46.32*10.43 ± 0.75*
Frozen L38.35 ± 0.12*9.42 ± 0.28*35.36 ± 2.28*649.67 ± 18.61*10.96 ± 0.31*

Infected-TCEFresh L38.67 ± 0.52*#9.90 ± 0.26*#38.47 ± 2.05*#558.67 ± 35.85*#9.03 ± 0.60*#
Thermal L39.80 ± 0.47*#11.90 ± 0.36*#42.46 ± 0.93*#453.67 ± 14.18*#7.83 ± 0.15*#
Frozen L39.48 ± 0.32*#10.90 ± 0.30*#40.70 ± 1.41*#487.00 ± 18.52*#8.07 ± 0.25*#
DOI: https://doi.org/10.2478/helm-2025-0038 | Journal eISSN: 1336-9083 | Journal ISSN: 0440-6605
Language: English
Page range: 340 - 351
Submitted on: Oct 10, 2025
Accepted on: Jan 30, 2026
Published on: Dec 31, 2025
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2025 M. Alotaibi, R. Abdel-Gaber, S. Al Quraishy, S. Santourlidis, H. M. Alharbi, E. Al-Shaebi, published by Slovak Academy of Sciences, Institute of Parasitology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.