Have a personal or library account? Click to login
Molecular characterization of Bertiella studeri infecting a primate in South India Cover

Molecular characterization of Bertiella studeri infecting a primate in South India

Helminthologia
Volume 61 (2024): Issue 2 (June 2024)
By: P. F. Sebasteena,  C. K. Deepa,  A. Varghese,  K. G. Ajith Kumar,  A. Joy,  A. Iype,  A. Rajappan,  G. Chandy and  R. Ravindran  
Open Access
|Jul 2024

Figures & Tables

Fig. 1.

Proglottids of B. studeri.A – mature segment of B. studeri, B – gravid segment of B. studeri
Proglottids of B. studeri.A – mature segment of B. studeri, B – gravid segment of B. studeri

Fig. 2.

Phylogenetic tree constructed using 18SrRNA gene sequence of B. studeri.The evolutionary history was inferred by using the Maximum Likelihood method and Hasegawa-Kishino-Yano model. The tree with the highest log likelihood (−1247.04) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. This analysis involved 16 nucleotide sequences. There was a total of 315 positions in the final dataset. Evolutionary analyses were conducted in MEGA X.
Phylogenetic tree constructed using 18SrRNA gene sequence of B. studeri.The evolutionary history was inferred by using the Maximum Likelihood method and Hasegawa-Kishino-Yano model. The tree with the highest log likelihood (−1247.04) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. This analysis involved 16 nucleotide sequences. There was a total of 315 positions in the final dataset. Evolutionary analyses were conducted in MEGA X.

Fig. 3.

Phylogenetic tree constructed using COX1 gene sequence of B. studeri.The evolutionary history of B. studeri was inferred by using the Maximum Likelihood method and Hasegawa-Kishino-Yano model. The tree with the highest log likelihood (−1017.95) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. This analysis involved 13 nucleotide sequences.
Phylogenetic tree constructed using COX1 gene sequence of B. studeri.The evolutionary history of B. studeri was inferred by using the Maximum Likelihood method and Hasegawa-Kishino-Yano model. The tree with the highest log likelihood (−1017.95) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. This analysis involved 13 nucleotide sequences.

Fig.4.

Phylogenetic tree constructed using ITS1-5.8S gene sequence of B. studeri.The evolutionary history was inferred by using the Maximum Likelihood method and Hasegawa-Kishino-Yano model. The tree with the highest log likelihood (−1819.29) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. This analysis involved 9 nucleotide sequences. There was a total of 604 positions in the final dataset.
Phylogenetic tree constructed using ITS1-5.8S gene sequence of B. studeri.The evolutionary history was inferred by using the Maximum Likelihood method and Hasegawa-Kishino-Yano model. The tree with the highest log likelihood (−1819.29) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. This analysis involved 9 nucleotide sequences. There was a total of 604 positions in the final dataset.

Fig.5.

Minimum spanning network of B. studeri species complex determined by A) 18SrRNA, B) COX1, C) ITS1-5.8S genes using POPART program. The size of a circle indicates the relative frequency of sample such as B. studeri and Bertiella spp.Hatch marks (numbers) along the branches indicate the numbers of mutations. Each colour indicates a different geographic area.
Minimum spanning network of B. studeri species complex determined by A) 18SrRNA, B) COX1, C) ITS1-5.8S genes using POPART program. The size of a circle indicates the relative frequency of sample such as B. studeri and Bertiella spp.Hatch marks (numbers) along the branches indicate the numbers of mutations. Each colour indicates a different geographic area.

Frequency of haplotypes of Bertiella spp_ in different countries_

18SrRNACOX1ITS1-5.8 S
HaplotypeFrequencyCountryHaplotypeFrequencyCountryHaplotypeFrequencyCountry
Hap_12India, Mauritius,Hap_11IndiaHap_11India
Hap_22ArgentinaHap_25Sri LankaHap_22Japan
Hap_34Sri LankaHap_32Sri LankaHap_32Argentina
Hap_41SpainHap_41ArgentinaHap_43Uganda
Hap_55Guinea-Bissau, Uganda, Rwanda, Brazil, PeruHap_51Argentina
Hap_61Central African RepublicHap_61Kenya
Hap_71Uganda
Hap_81Peru
Hap_91Indonesia

Details of PCR primers used in this study_

OrganismGenePrimersAmplification conditionsAmplicon length (bp)References
B. studeri18SrRNA

  • F 5′AACCTGGTTGATCCTGCCAGT3′

  • R 5′TGATCCTTCTGCAGGTTCACCTAC3′

denaturation at 94ºC for 3 min; 30 cycles of 94ºC for 30 s; 55ºC for 1min; 72ºC for 1 min; final extension at 72ºC for 10 min412Medlin et al., 1988
B. studeriCOX1

  • F 5′TGGTTTTTTGTGCATCCTGAGGTTTA3′

  • R 5′AGAAAGAACGTAATGAAAATGAGCAAC3′

denaturation at 94ºC for 1 min 30 s; 30 cycles of 94ºC for 50 s; 45ºC for 1 min 30 s; 72ºC of 1 min 30 s; final extension at 72ºC for 7 min448Okamoto et al., 1997
B. studeriITS1-5.8S

  • F 5′GCGGAAGGATCATTACACGTTC3′

  • R 5′GCTCGACTCTTCATCGATCCACG3′

denaturation at 94ºC for 2 min; followed by first cycle; 94°C for 2 min; 63°C for 2 min; 72°C for 1 min; 34 cycles of 94°C for 20 s; 63°C 20 s; 72°C 45 s; final extension at 72ºC for 7 min806MacNish et al., 2002
DOI: https://doi.org/10.2478/helm-2024-0015 | Journal eISSN: 1336-9083 | Journal ISSN: 0440-6605
Journal RSS Feed
Language: English
Page range: 109 - 115
Submitted on: Sep 12, 2023
|
Accepted on: Mar 7, 2024
|
Published on: Jul 16, 2024
Published by: Slovak Academy of Sciences, Institute of Parasitology
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open
Keywords:
Cestode,
18SrRNA,
ITS1-5.8S,
COX1,
Phylogeny,
Haplotypes
Related subjects:
Life sciences,
Zoology,
Ecology,
Life sciences, other,
Medicine,
Clinical medicine,
Microbiology, virology and infection epidemiology

© 2024 P. F. Sebasteena, C. K. Deepa, A. Varghese, K. G. Ajith Kumar, A. Joy, A. Iype, A. Rajappan, G. Chandy, R. Ravindran, published by Slovak Academy of Sciences, Institute of Parasitology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Volume 61 (2024): Issue 2 (June 2024)Next article