Skip to main content
Have a personal or library account? Click to login
Down-regulation of neuronal form of Nitric oxide synthase in the Nurse cell of Trichinella spiralis Cover

Down-regulation of neuronal form of Nitric oxide synthase in the Nurse cell of Trichinella spiralis

Open Access
|Apr 2024

Figures & Tables

Table 1.

The full names of the investigated genes and their primers sequences used in this study.

GeneAbbreviationSpeciesAccession numberPrimers sequences (5‘-3‘)Product size (bp)
Glyceraldehyde 3-phosphate dehydrogenaseGapdhMus musculusNM_001289726, transcript variant 1TCCTCGTCCCGTAGACAAAATG – F103
AATCTCCACTTTGCCACTGC – R
Nitric oxide synthase 1Nos1Mus musculusNM_008712.3CCAGCCAAAGCAGAGATGAAAG – F121
TCCCCCACAGATCATTGAAGAC – R
Expansion segment VESVTrichinella spiralis*GTTCCATGTGAACAGCAGT – F173
CGAAAACATACGACAACTGC – R
Fig. 1.

Immunohistochemistry. Modified methacarn fixed sections from mouse skeletal muscles with Trichinella spiralis at days 14, 24, and 35 post invasion (d.p.i.) were stained with polyclonal rabbit anti-nNOS/NOS Type 1 antibody. Parallel sections were subjected to H&E staining to facilitate the histological orientation. The brown colour indicates a positive immunohistochemical reaction, hashtag indicates the occupied sarcoplasma, star – non-occupied skeletal muscle fibre, arrow – enlarged nucleus, L – larva. H&E, anti-mouse peroxidase conjugate, DAB. Obj. magn. – 20x, scale bar 20 μm.

Fig. 2.

Agarose gel analysis of Trichinella spiralis ESV fragment PCR. Polymerase chain reaction was performed on modified methacarn fixed mouse skeletal muscle tissue sections, selected on days 0, 14, 24, and 35 after T. spiralis invasion. Genomic DNA from T. spiralis infectious larvae was used as a positive control sample. Presence of 173 bp fragment of expansion segment V of the T. spiralis genome was detected only in the mouse samples collected on days 14, 24 and 35 after the invasion. The photograph is representative of three randomly selected samples from each experimental group.

Fig. 3.

Expression of mouse Nitric oxide synthase 1 (Nos1) analysed by realtime RT-PCR in modified methacarn fixed mouse skeletal muscle tissue sections, selected on days 0, 14, 24, and 35 after T. spiralis invasion. The graphs show the relative quantification of the gene expressions calculated by the ΔΔCt method versus glyceraldehyde phosphate dehydrogenase (Gapdh) as a reference gene from five individual samples in triplicate. The bars show the standard error of the mean. The products of amplification were loaded on 2.5% agarose gel versus Perfect 100–1000 bp DNA Ladder.

DOI: https://doi.org/10.2478/helm-2024-0003 | Journal eISSN: 1336-9083 | Journal ISSN: 0440-6605
Language: English
Page range: 40 - 45
Submitted on: Aug 24, 2023
Accepted on: Nov 16, 2023
Published on: Apr 23, 2024
Published by: Slovak Academy of Sciences, Institute of Parasitology
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2024 R. Milcheva, Z. Hurníková, K. Todorova, V. Dilcheva, S. Petkova, P. Janega, P. Babál, published by Slovak Academy of Sciences, Institute of Parasitology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.