Have a personal or library account? Click to login
Detection of DNA Microsatellites Using Multiplex Polymerase Chain Reaction Aboard the International Space Station Cover

Detection of DNA Microsatellites Using Multiplex Polymerase Chain Reaction Aboard the International Space Station

Gravitational and Space Research
Volume 9 (2021): Issue 1 (January 2021)
By: Sophia Chen,  John Hatch,  Ashley Luck,  Nicole M. Nichols,  Emily J. Gleason,  Kathryn Martin,  Kevin D. Foley,  D. Scott Copeland,  Sebastian Kraves and  Ezequiel Alvarez Saavedra  
Open Access
|Dec 2021

Figures & Tables

Figure 1

Experimental approach and gel electrophoresis results. (A) PCR samples were prepared on the ground and frozen at −80°C prior to launch to ISS. PCR took place aboard the ISS and amplified samples were frozen at −80°C for return to Earth. Electrophoresis was carried out on the ground. (B) Gel electrophoresis image of PCR products. NR-27, NR-21, NIR-24, BAT-25, and BAT-26 are the five microsatellites. MSS and MSI indicate the source of template DNA. Samples were amplified either on the ground (G) or in space (S).
Experimental approach and gel electrophoresis results. (A) PCR samples were prepared on the ground and frozen at −80°C prior to launch to ISS. PCR took place aboard the ISS and amplified samples were frozen at −80°C for return to Earth. Electrophoresis was carried out on the ground. (B) Gel electrophoresis image of PCR products. NR-27, NR-21, NIR-24, BAT-25, and BAT-26 are the five microsatellites. MSS and MSI indicate the source of template DNA. Samples were amplified either on the ground (G) or in space (S).

Figure 2

Determination of microsatellite sizes of pentaplex reactions by capillary electrophoresis. Capillary electrophoresis traces of pentaplex amplification reactions from either MSI or MSS samples performed either on the ground or in space show amplification of all five target sequences (NR-27, FAM channel, blue; NR-21, PET channel, red; NR-24, VIC channel, green; BAT-25, FAM channel, blue; BAT-26, PET channel, red).
Determination of microsatellite sizes of pentaplex reactions by capillary electrophoresis. Capillary electrophoresis traces of pentaplex amplification reactions from either MSI or MSS samples performed either on the ground or in space show amplification of all five target sequences (NR-27, FAM channel, blue; NR-21, PET channel, red; NR-24, VIC channel, green; BAT-25, FAM channel, blue; BAT-26, PET channel, red).

Amplicon size comparison for single and pentaplex PCR_

NR-27NR-21NR-24BAT-25BAT-26
PentaSinglePentaSinglePentaSinglePentaSinglePentaSingle
Ground MSI74.773.6102.6102.8115.8115.9141.7141.7168.4168.9
Space MSI73.973.9102.1102.1115.5115.8141.6141.6168.3168.2
Ground MSS84.684.6107.2108.0122.4122.4145.5145.4180.7180.6
Space MSS84.584.5107.2107.2122.4122.3145.4144.5180.6180.5

Amplification reactions run on the ISS_

Reaction 1DNAPrimers
1MSSPentaplex: NR-27, NR-21, NR-24, BAT-25, BAT-26
2MSIPentaplex: NR-27, NR-21, NR-24, BAT-25, BAT-26
3MSSNR-27
4MSINR-27
5MSSNR-21
6MSINR-21
7MSSNR-24
8MSINR-24

Microsatellite markers targeted in this investigation_

Microsatellite markerPrimer sequencesFluorescent labelExpected size MSS (bp)Expected size MSI (bp)
NR-27AACCATGCTTGCAAACCACTCGATAATACTAGCAATGACCFAM9087
NR-21GAGTCGCTGGCACAGTTCTACTGGTCACTCGCGTTTACAAHEX110107
NR-24GCTGAATTTTACCTCCTGACATTGTGCCATTGCATTCCAANED129126
BAT-25TACCAGGTGGCAAAGGGCATCTGCATTTTAACTATGGCTCFAM152148
BAT-26CTGCGGTAATCAAGTTTTTAG AACCATTCAACATTTTTAACCCHEX182179
DOI: https://doi.org/10.2478/gsr-2021-0013 | Journal eISSN: 2332-7774
Journal RSS Feed
Language: English
Page range: 164 - 170
Published on: Dec 31, 2021
Published by: American Society for Gravitational and Space Research
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year
Keywords:
Microsatellites,
Polymerase Chain Reaction,
space travel,
genomic instability
Related subjects:
Life sciences,
Life sciences, other,
Materials sciences,
Materials sciences, other,
Physics,
Physics, other

© 2021 Sophia Chen, John Hatch, Ashley Luck, Nicole M. Nichols, Emily J. Gleason, Kathryn Martin, Kevin D. Foley, D. Scott Copeland, Sebastian Kraves, Ezequiel Alvarez Saavedra, published by American Society for Gravitational and Space Research
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Previous articleVolume 9 (2021): Issue 1 (January 2021)Next article