Have a personal or library account? Click to login
Clinorotation Affects Induction of the Heat Shock Response in Arabidopsis thaliana Seedlings Cover

Clinorotation Affects Induction of the Heat Shock Response in Arabidopsis thaliana Seedlings

Gravitational and Space Research
Volume 6 (2018): Issue 1 (July 2018)
By: Liudmyla Y. Kozeko,  Denis D. Buy,  Yaroslav V. Pirko,  Yaroslav B. Blume and  Elizaveta L. Kordyum  
Open Access
|Jul 2020

Figures & Tables

Figure 1

An effect of clinostat rotation on induction of HSP70 and HSP90 genes in Arabidopsis thaliana (Col) seedlings during heat shock. 12-d-old seedlings grown under stationary conditions (control) or clinorotation were exposed at 37°C for the indicated times. Expression levels were assessed using RT-qPCR, and normalized with respect to UBQ5 mRNA. Relative mRNA amounts were calculated as a fold change to the control (= 0 h of the heat treatment). Data are means of three independent biological samples with three analytical replicates ± s.d. The effect of high temperature was significant for all the HSPs; the effect of clinorotation was significant for AtHSP70-2, AtHSP70-3, AtHSP70-4, AtHSP70-5, and AtHSP90-1 (Two-way ANOVA, p < 0.05).
An effect of clinostat rotation on induction of HSP70 and HSP90 genes in Arabidopsis thaliana (Col) seedlings during heat shock. 12-d-old seedlings grown under stationary conditions (control) or clinorotation were exposed at 37°C for the indicated times. Expression levels were assessed using RT-qPCR, and normalized with respect to UBQ5 mRNA. Relative mRNA amounts were calculated as a fold change to the control (= 0 h of the heat treatment). Data are means of three independent biological samples with three analytical replicates ± s.d. The effect of high temperature was significant for all the HSPs; the effect of clinorotation was significant for AtHSP70-2, AtHSP70-3, AtHSP70-4, AtHSP70-5, and AtHSP90-1 (Two-way ANOVA, p < 0.05).

Figure 2

An effect of clinostat rotation on expression of HSP70 and HSP90 genes in Arabidopsis thaliana (Col) seedlings. The bars present the fold change of transcript abundance in 12-d-old seedlings grown under clinorotation relative to the control (seedlings grown under stationary conditions, = 1; dotted line). HSP90 c represents AtHSP90-2, AtHSP90-3, and AtHSP90-4 (in total). Bars denoted with an asterisk (*) indicate differences between the rotated and control seedlings that are statistically significant, compared with the control (Student's t-test, p < 0.05). Expression levels were assessed using RT-qPCR and normalized with respect to UBQ5 mRNA. Data are means of three independent biological samples with three analytical replicates ± s.d.
An effect of clinostat rotation on expression of HSP70 and HSP90 genes in Arabidopsis thaliana (Col) seedlings. The bars present the fold change of transcript abundance in 12-d-old seedlings grown under clinorotation relative to the control (seedlings grown under stationary conditions, = 1; dotted line). HSP90 c represents AtHSP90-2, AtHSP90-3, and AtHSP90-4 (in total). Bars denoted with an asterisk (*) indicate differences between the rotated and control seedlings that are statistically significant, compared with the control (Student's t-test, p < 0.05). Expression levels were assessed using RT-qPCR and normalized with respect to UBQ5 mRNA. Data are means of three independent biological samples with three analytical replicates ± s.d.

Figure 3

An effect of clinostat rotation on heat shock survival of Arabidopsis thaliana (Col) seedlings. 12-d-old seedlings grown under stationary conditions (control) (A, B) or clinorotation (C, D) at 22 ± 1°C were exposed at 45°C for 45 min and recovered under the stationary conditions. (A, C) seedlings before the heat treatment and (B, D) seedlings after a 6-d recovery period (B, D). (E) Survival rate of the seedlings after the heat treatment. Data are means ± s.d. (n = 3 plates with ~25 seedlings each; * Student's t-test, p < 0.05).
An effect of clinostat rotation on heat shock survival of Arabidopsis thaliana (Col) seedlings. 12-d-old seedlings grown under stationary conditions (control) (A, B) or clinorotation (C, D) at 22 ± 1°C were exposed at 45°C for 45 min and recovered under the stationary conditions. (A, C) seedlings before the heat treatment and (B, D) seedlings after a 6-d recovery period (B, D). (E) Survival rate of the seedlings after the heat treatment. Data are means ± s.d. (n = 3 plates with ~25 seedlings each; * Student's t-test, p < 0.05).

Figure 4

An effect of clinostat rotation on heat shock survival of Arabidopsis thaliana (Col) seedlings. (A) 5-d-old seedlings grown in the stationary conditions or under clinostat rotation at 22 ± 1°C were exposed at 45°C for 45 min, and recovered under the stationary conditions for 3 d. (B) Survival rate of the seedlings after the heat treatment. Data are means ± s.d. (n = 3; * Student's t-test, p < 0.05).
An effect of clinostat rotation on heat shock survival of Arabidopsis thaliana (Col) seedlings. (A) 5-d-old seedlings grown in the stationary conditions or under clinostat rotation at 22 ± 1°C were exposed at 45°C for 45 min, and recovered under the stationary conditions for 3 d. (B) Survival rate of the seedlings after the heat treatment. Data are means ± s.d. (n = 3; * Student's t-test, p < 0.05).

Primers of target genes used for RT-qPCR_

Gene nameAGI codePrimer sequences (5’ to 3’)
AtHSP70-1AT5G02500F: AAACCCTAGCCGCCTTATTC
R: GATAGCTGGTCCTTCTCCTTTAC
AtHSP70-2AT5G02490F: AGCTTGTGAGAGAGCAAAGAG
R: ACGGGTGATTGGAGAATAGA
AtHSP70-3AT3G09440F: GACATTAGTGGAAACCCGAGAG
R: GTCTGAGCCGTAGATGACAAAG
AtHSP70-4AT3G12580F: AGGGCACGAACAAAGGACAACAAC
R: TCAGCCGACACATTCAGGATACCA
AtHSP70-5AT1G16030F: GGAGCTATCTCTGGGCTTAATG
R: GGCCTTCGTACCCTTCTTATC
AtHSP90-1AT5G52640F: GTTACCCTATCTACCTTTGGACCG
R: CTGCTTGTTGATGAGTTCCCAC
AtHSP90-2,AT5G56030To detect mRNA of three genes in total:
AtHSP90-3,AT5G56010F: GCTACCCAATCTCTCTCTGGATT
AtHSP90-4AT5G56000R: GTACTCCTCCTTGTTGATCTCCTC
AtUBQ5AT3G62250F: AACCCTTGAGGTTGAATCATCC
R: GTCCTTCTTTCTGGTAAACGT
DOI: https://doi.org/10.2478/gsr-2018-0001 | Journal eISSN: 2332-7774
Journal RSS Feed
Language: English
Page range: 2 - 9
Published on: Jul 20, 2020
Published by: American Society for Gravitational and Space Research
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year
Keywords:
Clinorotation,
Stress,
Heat Shock Proteins,
Thermotolerance
Related subjects:
Life sciences,
Life sciences, other,
Materials sciences,
Materials sciences, other,
Physics,
Physics, other

© 2020 Liudmyla Y. Kozeko, Denis D. Buy, Yaroslav V. Pirko, Yaroslav B. Blume, Elizaveta L. Kordyum, published by American Society for Gravitational and Space Research
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Volume 6 (2018): Issue 1 (July 2018)Next article