Validation of Methods to Assess the Immunoglobulin Gene Repertoire in Tissues Obtained from Mice on the International Space Station Cover

.blurhash-client-img { display: none !important; }

Validation of Methods to Assess the Immunoglobulin Gene Repertoire in Tissues Obtained from Mice on the International Space Station

Gravitational and Space Research

Volume 5 (2017): Issue 1 (July 2017)

By: Trisha A. Rettig, Claire Ward, Michael J. Pecaut and Stephen K. Chapes

Open Access

|Jul 2020

Figures & Tables

Bioinformatic analysis workflows. (A) Workflow for MiSeq® reference mapping strategy using CLC Genomics Workbench software, the ImMunoGeneTics (IMGT) data base and Excel. (B) Workflow for HiSeq® reference mapping strategy. (C) Workflow for MiSeq® and HiSeq® genome mapping strategy.

Decision-making matrix to remove duplicate sequence reads after IMGT processing. Mapped sequences that were identified using Illumina sequence identification tags and sequences identified multiple times were removed as outlined.

Top ten VH gene segments used among treatment groups. (A) The top ten VH gene segments for each treatment group are presented as a percent of repertoire with corresponding percent of repertoire in other treatment groups listed (because there is not complete overlap among the three treatments groups, 13 VH are presented). (B) Top VH gene segments are listed by rank order (most frequent to least frequent). Dark red indicates higher rank moving to white, of lower rank. VH-gene segments with identical ranks are displayed as ties.

Top ten Vκ used among treatment groups. (A) The top ten Vκ gene segments for each treatment group are presented as a percent of repertoire with corresponding percent of repertoire in other treatment groups listed (because there is not complete overlap among the three treatment groups, 15 Vκ are presented). (B) The top Vκ gene segments are listed by rank order (most frequent to least frequent). Dark red indicates higher rank moving to white, lower rank. VH-gene segments with identical ranks are displayed as ties.

D, J, and heavy chain constant usage among treatment groups. (A) DH gene segment usage by percent of repertoire. (B) JH gene segment usage by percent of repertoire. (C) Jκ gene segment usage by percent of repertoire. (D) Heavy chain constant region usage by percent of repertoire.

CDR3 AA sequence usage among treatment groups. (A) Usage of the top five most common heavy chain CDR3 AA sequences from each treatment group are presented as percent of repertoire (because there is not complete overlap among the three treatment groups, 10 IgH CDR3s are presented). (B) Most common heavy chain CDR3 AA sequence usage presented by rank. Dark red indicates higher rank moving to white, of lower rank. An x denotes that the AA sequence was not found. (C) Unique heavy chain CDR3 AA sequences identified within and among treatment groups. (D) Usage of the top five most common kappa chain CDR3 AA sequences are presented as percent of repertoire (because there is not complete overlap among the three treatment groups, 10 Igκ CDR3s are presented). (E) Most common heavy chain CDR3 AA sequence usage presented by rank. (F) Unique heavy chain CDR3 AA sequences identified within and among treatment groups.

Correlation of V-gene segments between genome and reference mapping. (A) Linear regression of median VH gene segment usage from genome and reference mappings. R2=0.9973, p<0.0001. (B) Linear Regression of median Vκ gene segment usage from genome and reference mapping. R2=0.9923, p<0.0001.

Comparison of mapping techniques in HiSeq® datasets_ Mapping techniques were compared by assessing the correlation of Vκ usage between multiple HiSeq® and MiSeq® datasets_ HiSeq® datasets included sequencing data from CASIS and NASA ground (G) or flight (F) RR1 mice_ The comparison groups are as follows:

		Reference¹	Genome²	Compared³

Cohort	N	R² (p-value)	R² (p-value)	R² (p-value)
CASIS G	3	0.030 (.0637)	0.101 (0.0015)	0.011 (.027)
CASIS F	3	0.001 (.776)	0.216 (<.0001)	0.042 (.074)
NASA G	7	< 0.001 (.854)	0.379 (<.0001)	0.013 (.262)
NASA F	7	0.004 (.521)	0.277 (<.0001)	0.006 (.476)

Sequencing and mapping results from the cells, tissue, and size selected treatment groups_

	Cells	Tissue	Size Selected
Total Reads	23.9 M	25.9 M	21.5 M
Post Cleaning	18.7 M	20.3 M	12M
IgH Mapped	278318	313194	327015
VH Mapped	12851	26559	42375
Igκ Mapped	261037	273562	264938
Vκ Mapped	20776	35719	64540
Heavy Chain Productive	2036	4991	8939
Heavy Chain Unknown	6139	11374	14047
Light Chain Productive	3439	6799	11595
Light Chain Unknown	6894	10462	12393

Sequences used for heavy chain identification_ Motifs used to determine the constant region of heavy chain Ig sequences_

Constant Region	Motif Sequence
IgA	GAGTCTGCGAGAAATCCCAC
IgD	GTAATGAAAAGGGACCTGAC
IgE	TCTATCAGGAACCCTCAGCT
IgG1/2b/2c	GCCAAAACAACAGCCCCATC
IgG3	AACAACAGCCCCATCGGTCT
IgM	TCAGTCCTTCCCAAATGTCT

DOI: https://doi.org/10.2478/gsr-2017-0001 | Journal eISSN: 2332-7774

Journal RSS Feed

Language: English

Page range: 2 - 23

Published on: Jul 20, 2020

Published by: American Society for Gravitational and Space Research

In partnership with: Paradigm Publishing Services

Publication frequency: 2 issues per year

Keywords:

Immunoglobulin Gene Use,

Next Generation Sequencing,

Related subjects:

Life sciences, other,

Materials sciences,

Materials sciences, other,

© 2020 Trisha A. Rettig, Claire Ward, Michael J. Pecaut, Stephen K. Chapes, published by American Society for Gravitational and Space Research
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Volume 5 (2017): Issue 1 (July 2017)Next article