Skip to main content
Have a personal or library account? Click to login
Validation of Methods to Assess the Immunoglobulin Gene Repertoire in Tissues Obtained from Mice on the International Space Station Cover

Validation of Methods to Assess the Immunoglobulin Gene Repertoire in Tissues Obtained from Mice on the International Space Station

Open Access
|Jul 2020

Figures & Tables

Figure 1

Bioinformatic analysis workflows. (A) Workflow for MiSeq® reference mapping strategy using CLC Genomics Workbench software, the ImMunoGeneTics (IMGT) data base and Excel. (B) Workflow for HiSeq® reference mapping strategy. (C) Workflow for MiSeq® and HiSeq® genome mapping strategy.

Figure 2

Decision-making matrix to remove duplicate sequence reads after IMGT processing. Mapped sequences that were identified using Illumina sequence identification tags and sequences identified multiple times were removed as outlined.

Figure 3

Top ten VH gene segments used among treatment groups. (A) The top ten VH gene segments for each treatment group are presented as a percent of repertoire with corresponding percent of repertoire in other treatment groups listed (because there is not complete overlap among the three treatments groups, 13 VH are presented). (B) Top VH gene segments are listed by rank order (most frequent to least frequent). Dark red indicates higher rank moving to white, of lower rank. VH-gene segments with identical ranks are displayed as ties.

Figure 4

Top ten Vκ used among treatment groups. (A) The top ten Vκ gene segments for each treatment group are presented as a percent of repertoire with corresponding percent of repertoire in other treatment groups listed (because there is not complete overlap among the three treatment groups, 15 Vκ are presented). (B) The top Vκ gene segments are listed by rank order (most frequent to least frequent). Dark red indicates higher rank moving to white, lower rank. VH-gene segments with identical ranks are displayed as ties.

Figure 5

D, J, and heavy chain constant usage among treatment groups. (A) DH gene segment usage by percent of repertoire. (B) JH gene segment usage by percent of repertoire. (C) Jκ gene segment usage by percent of repertoire. (D) Heavy chain constant region usage by percent of repertoire.

Figure 6

CDR3 AA sequence usage among treatment groups. (A) Usage of the top five most common heavy chain CDR3 AA sequences from each treatment group are presented as percent of repertoire (because there is not complete overlap among the three treatment groups, 10 IgH CDR3s are presented). (B) Most common heavy chain CDR3 AA sequence usage presented by rank. Dark red indicates higher rank moving to white, of lower rank. An x denotes that the AA sequence was not found. (C) Unique heavy chain CDR3 AA sequences identified within and among treatment groups. (D) Usage of the top five most common kappa chain CDR3 AA sequences are presented as percent of repertoire (because there is not complete overlap among the three treatment groups, 10 Igκ CDR3s are presented). (E) Most common heavy chain CDR3 AA sequence usage presented by rank. (F) Unique heavy chain CDR3 AA sequences identified within and among treatment groups.

Figure 7

Correlation of V-gene segments between genome and reference mapping. (A) Linear regression of median VH gene segment usage from genome and reference mappings. R2=0.9973, p<0.0001. (B) Linear Regression of median Vκ gene segment usage from genome and reference mapping. R2=0.9923, p<0.0001.

Comparison of mapping techniques in HiSeq® datasets_ Mapping techniques were compared by assessing the correlation of Vκ usage between multiple HiSeq® and MiSeq® datasets_ HiSeq® datasets included sequencing data from CASIS and NASA ground (G) or flight (F) RR1 mice_ The comparison groups are as follows:

Reference1Genome2Compared3
CohortNR2 (p-value)R2 (p-value)R2 (p-value)
CASIS G30.030 (.0637)0.101 (0.0015)0.011 (.027)
CASIS F30.001 (.776)0.216 (<.0001)0.042 (.074)
NASA G7< 0.001 (.854)0.379 (<.0001)0.013 (.262)
NASA F70.004 (.521)0.277 (<.0001)0.006 (.476)

Sequencing and mapping results from the cells, tissue, and size selected treatment groups_

CellsTissueSize Selected
Total Reads23.9 M25.9 M21.5 M
Post Cleaning18.7 M20.3 M12M
IgH Mapped278318313194327015
VH Mapped128512655942375
Igκ Mapped261037273562264938
Vκ Mapped207763571964540
Heavy Chain Productive203649918939
Heavy Chain Unknown61391137414047
Light Chain Productive3439679911595
Light Chain Unknown68941046212393

Sequences used for heavy chain identification_ Motifs used to determine the constant region of heavy chain Ig sequences_

Constant RegionMotif Sequence
IgAGAGTCTGCGAGAAATCCCAC
IgDGTAATGAAAAGGGACCTGAC
IgETCTATCAGGAACCCTCAGCT
IgG1/2b/2cGCCAAAACAACAGCCCCATC
IgG3AACAACAGCCCCATCGGTCT
IgMTCAGTCCTTCCCAAATGTCT
Language: English
Page range: 2 - 23
Published on: Jul 20, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2020 Trisha A. Rettig, Claire Ward, Michael J. Pecaut, Stephen K. Chapes, published by American Society for Gravitational and Space Research
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.