Skip to main content
Have a personal or library account? Click to login
Enabling the Spaceflight Methylome: DNA Isolated from Plant Tissues Preserved in RNAlater® Is Suitable for Bisulfite PCR Assay of Genome Methylation Cover

Enabling the Spaceflight Methylome: DNA Isolated from Plant Tissues Preserved in RNAlater® Is Suitable for Bisulfite PCR Assay of Genome Methylation

Open Access
|Jul 2020

Figures & Tables

Figure 1

Plant mass varies among genotypes. 100 mm2 Petri plates containing 11-day-old seedling of Col-0, met1-7, or elp2-5 Arabidopsis plants grown on 0.5x phytagel media. These plants were grown under the Veggie hardware at Kennedy Space Center and were used in the EVT for APEX04.

Figure 2

Agarose gel electrophoresis of gDNA extractions. Genomic DNA extraction from Col-0, met1-7, and elp2-5 root and shoot samples obtained from the EVT at KSC. Known genomic DNA purified using the CsCl method was diluted to gradient concentrations (50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78, 0.39, and 0.195 ng/μL) and used to generate a standard curve by which the DNA samples were quantified by band intensity. For each sample, 5 μL of DNA solution was loaded.

Figure 3

Exemplary DNA samples analyzed by TapeStation. Roots and shoots from the Col-0 ecotype EVT samples were analyzed on the Agilent 2200 TapeStation System using the Genomic DNA ScreenTape, generating concentration values and DNA Integrity Number (DIN). L–molecular weight ladder, S–CsCl purified gDNA standard.

Figure 4

PCR amplification products from exonic regions of AT2G07698 and AT2G07687 shoots from Col-0, met1-7, or elp2-5. PCR-generated samples were run out on 1% agarose gel, and stained with ethidium bromide. The amplified region from AT2G07698 is expected to be 316 bases and from AT2G07687 is expected to be 398 bases (see Table 2).

Figure 5

DNA methylation present in AT2G07698 from gDNA samples extracted for the EVT. DNA methylation levels in the CG (A), CHG (B), and CHH (C) context in a window of ~200 b.p. in PCR detected exonic regions of AT2G07698 (+253 to + 507 from ATG) from shoot DNA samples of Col-0, met1-7, and elp2-5. Each column represents the percent of 15 TA colonies that had a methylated cytosine at a given nucleotide site.

Figure 6

DNA methylation present in AT2G07687 from gDNA samples extracted for the EVT. DNA methylation levels in the CG (A), CHG (B), and CHH (C) context in a window of ~200 b.p. in PCR detected exonic regions of AT2G07687 (+19 to + 355 from ATG) from shoot DNA samples of Col-0, met1-7, and elp2-5. Each column represents the percent of 15 TA colonies that had a methylated cytosine at a given nucleotide site.

PCR primer sequences_ The bisulfite primer seeker designed by Zymo Research was used to select regions to amplify from the exons of AT2G07698 and AT2G07687_

PrimerSequence (5' to 3')Tm (°C)Product Size (bp)
AT2G07698-FTAAATATTTTTTTTTTATTTGTTTTTGGAG50.1254
AT2G07698-RTAAAACRAAACTATAAAAAAAAAAAAAAAAAC51.6
AT2G07687-FAGATAAAGTGGTTTATGATTGAATTTTAGAGG55.6337
AT2G07687-RATCTAAAACCTCAATCCCTTTTAAAAACC55.9

Quantification of gDNA extractions_ Qubit quantification of DNA extraction samples corresponding to Figure 2_ Standard DNA with known concentration was used as positive control_ The amount of roots or shoots used for DNA extraction and concentration of each DNA sample were listed_

Sample# of plants[DNA] (ng/μL)
Col-0 R11030.8
Col-0 R21014.9
Col-0 R31026.0
Col-0 R41023.6
Col-0 S11027.2
Col-0 S21025.6
Col-0 S31027.2
Col-0 S41029.4
met1-7 R11619.8
met1-7 R21615.2
met1-7 R31620.6
met1-7 R4169.06
met1-7 S11637.2
met1-7 S21631.8
met1-7 S31630.8
met1-7 S41622.4
elp2-5 R1169.24
elp2-5 R2259.24
elp2-5 R32513.0
elp2-5 R41712.3
elp2-5 S11647.4
elp2-5 S22549.2
elp2-5 S32536.6
elp2-5 S41745.4
Language: English
Page range: 28 - 37
Published on: Jul 18, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2020 Collin E. LeFrois, Mingqi Zhou, David Moraga Amador, Natasha Sng, Anna-Lisa Paul, Robert J. Ferl, published by American Society for Gravitational and Space Research
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.