Skip to main content
Have a personal or library account? Click to login
Microarray Identifies Transcription Factors Potentially Involved in Gravitropic Signal Transduction in Arabidopsis Cover

Microarray Identifies Transcription Factors Potentially Involved in Gravitropic Signal Transduction in Arabidopsis

Open Access
|Dec 2015

Full Article

INTRODUCTION

On Earth, gravity is a constant stimulus governing a plant’s growth and orientation of its organs. A plant’s response to gravity can be separated into four phases: perception of the gravity stimulus, transduction of that perception event into a biochemical signal, transmission of that signal to the site of response, and the differential growth response of the plant organs (Morita and Tasaka, 2004). The gravity persistent signal (GPS) treatment involves a cold treatment to isolate the processes of signal transduction prior to auxin redistribution. When plants are reoriented with respect to gravity at 4°C, perception of the stimulus occurs, but auxin transport is virtually eliminated; however, when returned to vertical at room temperature (RT), auxin transport is restored and plants bend in response to the reorientation in the cold (Wyatt et al., 2002). The delayed curvature indicates that some component between perception and transmission of the signal is inhibited in the cold. Taking advantage of this GPS phenomenon, a gene expression microarray was conducted on plants subjected to the GPS treatment to identify additional molecular components or physiological processes involved in the gravitropic pathway. The goal of this ongoing research is to identify genes involved in the early events of gravitropic signal transduction. Here, we describe our initial work focused on transcription factors that are differentially expressed at early time points after reorientation of plants at 4°C.

METHODS AND MATERIALS
Plant Materials and Growth Conditions

Arabidopsis thaliana var. Columbia was used both for the microarray experiment and as the wild type (WT) control for the mutant analyses. For all experiments, seeds were planted into Pro-Mix BX Mycorrhizae general purpose growing medium (Premier Tech, Quebec, Canada) in 6 cm pots. Seeds were cold stratified at 4°C for two days, then allowed to germinate and grow at 21°C in 16 h light:8 h dark photoperiod. Plants were thinned to 3-4 per pot at 2 weeks after germination.

Microarray Analysis

Plants were grown to maturity with inflorescence stems of 8-10 cm. All plants were initially held vertically at 4°C for 1 h as a cold acclimation period. Half the plants were then reoriented 90° (treatment) with respect to the gravity vector and half the plants were gently moved to simulate the movement of reorientation but maintained vertical (control), all at 4°C. RNA was extracted from four time points after reorientation in the cold: 2, 4, 10, and 30 min. Inflorescence stems were flash frozen in liquid nitrogen at each time point, leaves and flowers removed, and the apical 4 cm of the stems pooled and homogenized in liquid nitrogen. Four biological replicates were prepared for each control and treatment samples at each time point, totaling 32 samples. Total RNA was extracted using Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA). RNA samples with an RNA Integrity Number (RIN) value of 8.5 or greater (Bioanalyzer, Agilent Technologies, Santa Clara, CA) were used for analysis. cDNA was synthesized from RNA with the Applied Biosystems High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Marietta, OH) using thermocycler settings as follows: 10 min at 25°C, 120 min at 37°C, 5 min at 85°C. cDNAs were labeled with Cy3 (yellow-green) and Cy5 (red) dyes, then hybridized to a total of 16 4X44k dual color Arabidopsis arrays (Agilent Technologies, Santa Clara, CA) using a dye swap protocol between control and treatment samples. The probe arrays were scanned by a SureScan Microarray scanner, and the raw optical intensities were captured by the feature collection software.

Microarray Data Analysis

Data were analyzed using ArrayOU, a web based microarray analysis package (Shen et al., 2012). Background noise was corrected using normexp (offset=50), and the value of the signal density in both treatment and control samples was calculated for each array. Signal densities varied slightly and were normalized across each array using “loess” to adjust for effects caused by the dual channels of the microarray. Data were normalized within arrays using “Aquantile”. Significance was calculated using an empirical Bayesian model with Benjamini and Hochberg corrections. Genes in the dataset having a log fold change (LFC) greater than 1 or less than -1, and a p-value less than 0.05, were considered significant. A subset of genes identified to be transcription factors were selected based on annotation through the Database of Arabidopsis Transcription Factors (Guo et al., 2005).

Quantitative Real-time PCR

Two-step quantitative real-time PCR (RT-qPCR) was performed with the DyNAmo Color Flash SYBR Green kit (Thermo Fisher Scientific, Marietta, OH). Real-time amplification was recorded by the Mx3000P RT-qPCR machine (Stratagene/Agilent Technologies, Santa Clara, CA). PP2A (AT1G10430) was used as the reference gene for all RT-qPCR assays. The following primers were used for RT-qPCR: for AtAIB, 5’- CCTGCTCCTGCTAACAAGCT -3’ and 5’-CTCTGCCTCTCAGCTTCCAC -3’; for WRKY18, 5’- ACACCAATCCTTTCTCCGCA -3’ and 5’- AAGACGAGAGCGCAAGTGAG -3’; for WRKY26, 5 ’- GGCCAAGAGATGGAAAAGAG AAG-3’ and 5’- TAAAACTGGACCTCTTCT TGGGG-3’; for WRKY33, 5’- AGCAAAG AGATGGAAAGGGGACAA-3’ and 5’- TGTGA TTACTGCTCTCATGTCGTGT-3’; for BT2, 5’-CGATGACGCCGAATCGAGGAAG-3’ and 5’-CCGTATGCAAGAGGAGGAATAACG-3’. Primer concentrations were optimized, and amplification specificity ensured. The thermocycler was set to an initial 7 min cycle at 95°C, 35 cycles of 15 sec at 95°C, and 30 sec at 60°C, then 10 min at 95°C to generate a dissociation curve. To ensure the selection of a stably expressed internal control, the geNorm algorithm (Vandesompele et al., 2002) was used to analyze potential reference genes recommended by Czechowski et al. (2005). The gene PP2A was selected as the reference gene. Assays were run using control and treatment template from all four time points, with each assay in triplicate. Relative quantification of the gene expression levels was performed using the comparative Cq method.

Mutant Phenotype Analysis

Arabidopsis lines with insertions in the genes of interest were obtained as seed stock from European Arabidopsis Stock Center (NASC) and Arabidopsis Biological Resource Center (ABRC). Seed of the following germplasms were obtained: for AtAIB, SAIL_536_F09 with an insertion in the exon; for WRKY18, GK_328G03 with an insertion in the intron; for WRKY26, SALK_063386 with an insertion in the gene; for WRKY33, SALK_006603 with an insertion in the intron; and for BT2, SALK_084470 with an insertion in the promoter. PCR to confirm homozygosity of the insertion was performed using three primers in each reaction: two specific to the gene of interest and the third complementary to the T-DNA insertion (5’-ATTTTGCCGATTTCGGAAC-3’ for SALK lines and 5’-TAGCATCTGAATTTCATAACCAATC TCGATACAC-3’ for SAIL lines).

Gene specific primers: for AtAIB 5’-AAGTCACCATTACTGGTTGCG-3’ and 5’-CA AGACTTGCTGGGGTAATTG-3’; for WRKY18 5’-GTGGTAATGAACAGAGCGCA-3’ and 5’-CAAATTGAGACTACGCACCAACTA-3’; for WRKY26, 5’- AGTTTGACGTGGGTAACGTTG-3’ and 5’- GAAATGTGCCTG TCGTAGGAG-3 ’; for WRKY33, 5’- CATTTTTCGTATGGCTGCT TC-3’ and 5’- TGAGCCTT GTTCGAACTCATC-3’; and for BT2, 5’- AATAACCGAACCAAA CCAACC-3’ and 5’- GATGCCATGGAAACA AAACAC-3’. Plants were grown to maturity and subjected to the GPS treatment (Wyatt et al., 2002). Briefly, plants were grown until inflorescence stems were 8-10 cm, cold acclimated for 1 h, reoriented 90° at 4°C for 1 h, and then returned to vertical at RT. Images were taken at 15 min intervals up to 90 min after the return to vertical at RT. GNU Image Manipulation Program (GIMP2) software was used to quantify the curvature of stems after plants were returned to vertical at RT. The average angle of curvature of the inflorescence stems was taken from a minimum of 15 plants each. Standard error was calculated, and significance determined using a Student’s t-test.

RESULTS

A gene expression microarray analysis combined with the GPS treatment was used to isolate genes involved in the early events of gravity signal transduction. Samples were collected across a time course of the GPS response; RNA was isolated from inflorescence stem tissue at 2, 4, 10, and 30 min after plants were reoriented at 4°C. Transcription factors were selected for analysis because of their potential role in gene regulation of the gravitropic signaling pathway. Transcription factors can have large-scale downstream effects on gene regulation and are involved in the activation of regulatory cascades (Bolouri and Davidson, 2003). Of the 1,907 transcription factors identified in the microarray dataset, five (AtAIB, WRKY18, WRKY26, WRKY33, and BT2) were selected based on differential expression (LFC≤-1.0) at the 4 min time point (Figure 1). No transcription factors were found to be differentially expressed at 2 min. Although BT2 had a LFC<-1.0 at 4 min, its expression was not statistically significant (p-value<0.10); however, differential expression at 10 min was significant (p-value<0.10) (Table 1), so it was included for further analysis.

Figure 1.

Selection of transcription factors for further study. A microarray analysis was performed on wild type Arabidopsis at 2, 4, 10, and 30 min after reorientation in the cold during the GPS treatment. Transcription factors were selected based on annotation from the Database of Arabidopsis Transcription Factors and evaluated based on differential gene expression at 2 and 4 min. No transcription factors were differentially expressed at 2 min. A scatter plot of gene expression of 33 transcription factors identified at the 4 min time point. Five transcription factors (circled) were selected for further analysis based on high differential expression (LFC≤-1): AtAIB, WRKY18, WRKY26, WRKY33, and BT2.

Table 1.

Microarray expression values of the five transcription factors across the GPS treatment.

2 min4 min10 min30 min
GeneLocus IDLFC*P-valueLFCP-valueLFCP-valueLFCP-value
WRKY26AT5G07100  1.35  0.11-1.76  0.00-0.53  0.31-0.94  0.09
AtAIBAT2G46510  0.50  0.16-1.03  0.04-0.16  0.67-0.24  0.32
WRKY33AT2G38470-0.34  0.18-1.00  0.02-0.01  0.99  0.13  0.76
BT2AT3G48360-0.41  0.74-1.41  0.10-1.59  0.01-1.26  0.08
WRKY18AT4G31800-0.11  0.86-1.08  0.05-1.83  0.02-1.24  0.03
*

log2 fold change

Transcription factors in the WRKY family are expressed rapidly and transiently in response to many different environmental stresses (Rushton et al., 1996; Hara et al., 2000). In this study, WRKY26 and WRKY33 were significantly down-regulated only at 4 min, while WRKY18 was down-regulated at 4, 10, and 30 min (Table 1).

Although microarrays are capable of whole genome profiling, they can also generate numerous false positive signals (Wang et al., 2006). Thus, RT-qPCR was performed on RNA collected from wild type (WT) plants to independently assess the expression of AtAIB, WRKY18, WRKY26, WRKY33, and BT2. For all genes, RT-qPCR showed significant differential expression at 2, 4, and 10 min (Figure 2). RT-qPCR indicated that WKRY 26, WRKY 33, and AtAIB were all up-regulated at 2 min, which was not evident in the microarray analysis but may prove interesting.

Figure 2.

RT-qPCR analysis. Relative gene expression of each transcription factor was quantified in inflorescence stems of wild type Arabidopsis (var. Columbia) plants either reoriented (grey bars) or held vertical (black bars) across the GPS treatment. Expression levels were assessed at 2, 4, 10, and 30 min after reorientation of the treatment group in the cold and normalized to the 2 min vertical control. Each assay was performed in triplicate. Asterisks indicate significance determined by a Student’s t-test (p-value<0.05).

The GPS phenotype was assessed on five individual Arabidopsis lines, each containing a T-DNA insertion in one of the genes: AtAIB, WRKY18, WRKY26, WRKY33, or BT2. First, plants were bred for homozygosity of the T-DNA insertion in the target gene (Figure 3). Once homozygous lines were isolated, plants were subjected to the GPS treatment using the WT var. Columbia as the control. The inflorescence stems of bt2 curved less as compared to those of WT, and conversely inflorescence stems of ataib curved more than those of WT throughout the response phase (Figure 4). Interestingly, the three WKRY mutants responded differently. wrky18 showed no significant difference in bending of inflorescence stems compared to WT, curvature in the inflorescence stems of wrky26 only differed significantly from WT after 45 min, and inflorescence stems of wrky33 curved less when compared to those of WT (Figure 4).

Figure 3.

Selection of homozygous mutants defective in each transcription factor: ataib, bt2, wrky18, wrky26, or wrky33. Arabidopsis lines with T-DNA inserts in the genes of interest were obtained from publicly available seed banks. Seed was planted, and DNA extracted from both wild type and mutant lines. PCR was used to confirm homozygous insertion in the gene of interest. Gene-specific forward and reverse primers and a primer complementary to the left border of the T-DNA insert for each mutant line were used to amplify DNA extracted from Columbia wild type (left) and the mutant indicated (right). Arrows (left) indicate the amplicon from the gene specific primers; the arrow heads (right) indicated the amplicon produced by a gene-specific primer and the T-DNA left border primer. Single bands in each lane indicate homozygosity of the allele.

Figure 4.

GPS phenotype of ataib, bt2, wrky18, wrky26, or wrky33. Seed for mutant (open circles) and Columbia wild type (closed circles) lines were planted, and plants grown to maturity with inflorescence stems of 8-10 cm. Plants were reoriented with respect to gravity at 4°C for 1 h then returned to vertical at RT. Images were taken every 15 min from 0-90 min after return to RT, and the angle of curvature for a minimum of 15 inflorescence stems was measured. Asterisks indicate significance difference, as determined by a Student’s t-test.

DISCUSSION

The GPS treatment involves a cold treatment to isolate the processes of signal transduction prior to auxin redistribution and may help to shed light on early events which link the perception of the biophysical stimulus and the biochemical response. Because transcription factors are essential elements of gene regulation and can have large-scale downstream effects on the expression of other genes, here, we focused on analysis of transcription factors from a microarray gene expression study across the GPS treatment. Early time points after reorientation of plants was of particular interest and since the presentation time of Arabidopsis has been estimated to be between 30 sec and 5 min (Sack et al., 1985; Kiss et al., 1989), the 2 and 4 min time points were chosen to survey the earliest transcription factors induced by gravity stimulus. Of the 1,907 transcription factors identified across the microarray data, and as annotated in the Database of Arabidopsis Transcription Factors, none were differentially expressed at 2 min. Five genes were selected for analysis based on differential expression at the 4 min time point: AtAIB, WRKY18, WRKY26, WRKY33, and BT2 (Figure 1). All transcription factors selected were down-regulated at the 4 min time point (Figure 1, Figure 2) but showed more variable expression at other time points (Figure 2).

Initial analysis of the GPS phenotype of mutants defective in each of the transcription factors showed a potentially complex story. Curvature of inflorescence stems of ataib increased after GPS treatment as compared to WT. AtAIB is an abscisic acid (ABA)-induced basic helix-loop-helix-type (bHLH) protein which has been shown to positively regulate ABA response (Li et al., 2007). In the roots, curvature in response to gravity is known to be influenced by ABA (Pilet and Barlow, 1987), as well as other hormonal regulators. Application of exogenous ABA to maize roots also promotes differential growth in response to gravity stimulus in darkness (Wilkins and Wain, 1975). Our results may indicate a role of ABA in curvature of stems in response to gravity.

Conversely, inflorescence stems of bt2 bent less after the GPS treatment as compared to WT. BT2 has been found to be involved in telomerase regulation (Ren et al., 2007) and in multiple plant responses to exogenous stimulations and stresses, including ABA (Mandadi et al., 2009). BT2 is believed to be a key player in multiple signal transduction pathways, and now we provide evidence to suggest a role in gravitropic signal transduction.

In our study, three WRKY transcription factors (WRKY18, 26, and 33) were all down-regulated at 4 min after reorientation in the cold. However, mutants defective in these genes do not share a phenotypic response; curvature of inflorescence stems of wrky18 was not significantly different from WT; whereas those of wrky26 over responded after 45 min, and inflorescence stems of wrky33 bend less than those of WT. The WRKY superfamily is one of the largest groups of transcriptional regulators in plants. These genes share the highly conserved WRKYGQK amino acid sequence at the N-terminus and function in various signaling pathways in plants. Potential targets of downstream regulation by WRKYs contain the W-box promoter element. WRKY18 was previously found to be pathogen-induced, forming protein heterocomplexes with WRKY40 and WRKY60 that function as bacterial pathogen defenses (Xu et al., 2006). These paralogous WRKYs have also been implicated in the regulation of ABA-induced genes (Shang et al., 2010; Chen et al., 2010; Liu et al., 2012). WRKY33 is also known to function in response to pathogen defense (Zheng et al., 2006; Birkenbihl et al., 2012) and in abiotic stress (Jiyang and Deyholos, 2009). WRKY33 and WRKY26 also appear to be involved in coordinating induction of plant thermo tolerance (Li et al., 2011). In space-flown experiments, WRKY18 was upregulated over 2-fold in the hypocotyls of 12-day-old Arabidopsis (Paul et al., 2013) and several WRKY genes (including homologs of WRKY 18 and 33) have been identified in Brassica rapa flown for 27 days aboard the International Space Station (ISS) (Sugimoto et al., 2014). Although only three WRKY genes were differentially expressed in our dataset, these and others have been implicated in other gravity-related studies, including microgravity, hypergravity, and parabolic flight (Martzivanou et al., 2006; Fengler et al., 2015; Soh et al., 2015).

The role of transcription factors is complex. In these preliminary studies, we focused on expression at early time points after reorientation hoping to identify transcriptional regulation of early events in gravitropic signaling. However, transcription factors are necessary for long-term responses to alterations in the gravity field or the spaceflight environment, and this adds to the complexity of the system. Further analysis of gravitropic phenotypes in the mutants will provide a better indication if these transcription factors are involved in early signaling events throughout the plant. Additional biochemical, physiological, and protein-protein interaction studies will be necessary to sort out the role these, and other, transcription factors play in gravitropic signaling and response.

Language: English
Page range: 20 - 29
Published on: Dec 1, 2015
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2015 C. Adam Cook, Avery Tucker, Kaiyu Shen, Sarah E. Wyatt, published by American Society for Gravitational and Space Research
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.