Skip to main content
Have a personal or library account? Click to login
The role of exogenous glutamine on germination, plant development and transcriptional expression of some stress-related genes in onion under salt stress Cover

The role of exogenous glutamine on germination, plant development and transcriptional expression of some stress-related genes in onion under salt stress

Open Access
|Feb 2024

Figures & Tables

Table 1.

Schematic representation of the experiment.

Treatments
First stageControl50 mM NaCl100 mM NaCl150 mM NaCl200 mM NaCl1 mM Gln2 mM Gln3 mM Gln4 mM Gln
Second stage150 mM NaCl + 1 mM Gln150 mM NaCl + 2 mM Gln150 mM NaCl + 3 mM Gln150 mM NaCl + 4 mM Gln

1 Gln, glutamine.

Table 2.

RAPD PCR primers and sequences.

PrimerPrimer sequence
RAPD25′ACGGTACCAG3′
RAPD75′TTCCGAACCC3′
OPPO55′CCCCGGTAAC3′
OPI185′TGCCCAGCCT3′
12OPC065′GAACGGACTC3′
14OPC095′CTCACCGTCC3′
19OPC145′TGCGTGCTTG3′
21OPC165′CACACTCCAG3′
OPW105′TCGCATCCCT3′
30OPAF055′CCCGATCAGA3′
25OPN015′CTCACGTTGG3′
S2375′ACCGGCTTGT3′

1 PCR, polymerase chain reaction; RAPD, randomly amplified polymorphic DNAs.

Table 3.

Genes, gene names, sequences and literature.

Gene IDGene namePrimer sequences (5→3’)Reference
SODSuperoxide dismutaseF TTCCTCCAGCATTCCCAGTGGhodke et al. (2020)
R ATGGCTTGACACATGGTGCT
SOD-2Superoxide dismutase 2, mitochondrialF GGCGAAGCAAACAGCCTCATJi et al. (2021)
R AGTATCGCCGAACGAGTGGA
AOL-ascorbate oxidase-likeF TGATGTTTGTGCTGTCTTTCGGGhodke et al. (2020)
R ACCGTGAAAGTGTTTGTGCT
POLD1DNA Polymerase Delta 1, catalytic subunitF AGACGACTCGCTGTGTATTGCTLyu et al. (2020)
R CCAGTAACTCGTGCCATCTCCA
ChapeChaperoneF TCCTGGCAAGTCTGCTTTGAGhodke et al. (2020)
R GGCTCTAATTCCTCGCGTTT
HSP2121 kDa proteinF TAGATGGATGGCGAACTCGGGhodke et al. (2020)
R TCTTCTTCTTCGCACTCCT
β-Actinβ-actinF TCCTAACCGAGCGAGGCTACATSun et al. (2013)
R GGAAAAGCACTTCTGGGCACC
18S18S ribosomal RNAF GAATGACTCCTGGCAATGLiu et al. (2015)
R GATTGGAATGACGCTATACA

1 Protocol: Step 1 for the qRT-PCR reaction: enzyme activation: 95°C, 10 min; Step 2: denaturation: 95°C, 15 s; primer bonding-chain elongation: 60°C-1 min, Step 3: melting curve: 95°C, 15 s, 60°C, 1 min, 95°C, 15 s.

Figure 1.

Changes in GP, MGT, CVG, and GI caused by salt stress and Gln treatments. Statistically significant differences between treatments are shown in the bar graphs with different letters. According to one-way ANOVA (Tukey test), statistically significant differences were determined between the experimental groups at the p ≤ 0.05 level. ANOVA, analysis of variance; CVG, coefficient of velocity of germination; GI, germination index; GP, germination percentage; MGT, mean germination time.

Table 4.

Changes in the vegetative growth of onions at different Gln concentrations under salt-stress and non-stress conditions.

TreatmentsSL (mm)RL (mm)SFW (g)RFW (g)SDW (g)RDW (g)TLN (no.)
Control300.78 ab335.30 a4.7717 bc5.3486 a0.2974 b0.2578 b5.4 c
50 mM NaCl200.50 abc174.67 b3.3849 c1.8111 bcd0.2423 b0.1269 cd6.0 c
100 mM NaCl176.14 bcd99.98 bcd3.0034 c0.9761 cd0.3421 b0.0514 de4.7 c
150 mM NaCl55.37 de54.16 cd1.6138 c0.7861 cd0.1272 b0.0980 de4.3 c
200 mM NaCl35.96 e30.95 d0.6784 c0.2976 d0.1009 b0.0250 e3.6 c
1 mM Gln265.67 ab78.67 bcd5.6750 abc2.0207 bcd0.3935 b0.1229 cd6.7 bc
2 mM Gln316.00 a131.33 bc11.1293 a3.1972 b5.0274 a0.2022 bc11.6 ab
3 mM Gln269.00 ab70.00 cd10.4772 ab2.8864 bc3.4157 a0.9267 a13.7 a
4 mM Gln243.67 ab68.67 cd6.4551 abc2.2977 bcd4.5882 a0.2567 b6.6 bc
150 mM NaCl+ 1 mM Gln64.67 de79.67 bcd1.3471 c1.8282 bcd0.1246 b0.1017 de3.7 c
150 mM NaCl+ 2 mM Gln65.33 de78.00 cd1.6087 c1.3310 bcd0.1228 b0.1293 cd6.0 c
150 mM NaCl+ 3 mM Gln81.67 cde84.67 bcd1.7282 c1.8951 bcd0.1594 b0.1341 cd6.6 bc
150 mM NaCl+ 4 mM Gln77.67 cde64.00 cd0.8713 c1.1304 bcd0.1030 b0.1166 cde5.7 c
**************

1 Statistically, the differences between the applications are shown with different letters (Tukey). ** p ≤ 0.001, * p ≤ 0.005, ns: not significant. Gln: glutamine, SL: shoot length, RL: root length, SFW: shoot fresh weight, RFW: root fresh weight, SDW: shoot dry weight; RDW: root dry weight; TLN: total leaf number.

Figure 2.

Linear projection of the distribution of applications according to plant growth and germination values and visualisation of the classification of applications according to the change in plant characteristics with heat map. (A) Linear projection according to germination attributes, (B) linear projection according to germination and vegetative attributes (C) heat map. By using the principal component analysis data in linear projection (A and B), a two-dimensional projection is presented in which different applications are best separated according to variables. As it can be followed from the scale on the heat map (C), the change of colours gives information about the effect of the applications on the variables. The lowest values are shown in dark blue. The change of colour towards white in the heat map showed that the values increased.

Figure 3.

Total Chl, Chl a, Chl b, Chl a/b and carotenoid amounts determined in leaf tissues of control and experimental groups of onion. Data are given as mean ± standard deviation, n = 5. The averages shown with different letters on the graph are statistically different from each other. One-way ANOVA, TUKEY HSD test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln, 12: 150 mM NaCl + 3 mM Gln, 13: 150 mM NaCl + 4 mM Gln). ANOVA, analysis of variance; Chl a, chlorophyll a; Chl a/b, chlorophyll a/b ratio; Chl b, chlorophyll b; total Chl, total chlorophyll.

Figure 4.

Gel image of the primers included in the analysis. (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln, 11: 150 mM NaCl + 2 mM Gln, 12: 150 mM NaCl + 3 mM Gln, 13: 150 mM NaCl + 4 mM Gln). L (Ladder): Fermantas zip ruler DNA ladder 100 bp.

Figure 5.

GTS in the control and treatment groups. n = 8, data mean ± standard error. Comparison of treatment groups compared to control, data are statistically different, one-way ANOVA test, *p ≤ 0.05, **p ≤ 0.01; #comparative applications vs. 150 mM NaCl, data are statistically different, independent groups t-test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln,12: 150 mM NaCl + 3mM Gln, 13: 150 mM NaCl + 4mM Gln). ANOVA, analysis of variance; GTS, genomic template stability.

Figure 6.

Relative fold increased values of antioxidant defence genes CuZn-SOD, Mn-SOD, AO, DNA damage repair gene POLD1, heat-shock molecular chaperone CHAPE and HSP21 gene expressions in leaf tissues in experimental groups (data are β-actin and normalised to 18S mRNA level by the multiple control method). Data are given as mean ± standard error, n = 5. The averages shown with different letters on the graph are statistically different from each other. One-way ANOVA, Tukey HSD test, p ≤ 0.05 (1: Control, 2: 1 mM Gln, 3: 2 mM Gln, 4: 3 mM Gln, 5: 4 mM Gln, 6: 50 mM NaCl, 7: 100 mM NaCl, 8: 150 mM NaCl, 9: 200 mM NaCl, 10: 150 mM NaCl + 1 mM Gln,11: 150 mM NaCl + 2 mM Gln,12: 150 mM NaCl + 3mM Gln, 13: 150 mM NaCl + 4 mM Gln). ANOVA, analysis of variance.

DOI: https://doi.org/10.2478/fhort-2024-0002 | Journal eISSN: 2083-5965 | Journal ISSN: 0867-1761
Language: English
Page range: 19 - 34
Submitted on: Oct 23, 2023
Accepted on: Jan 9, 2024
Published on: Feb 22, 2024
Published by: Polish Society for Horticultural Sciences (PSHS)
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year
Related subjects:

© 2024 Kamile Ulukapi, Ayse Gul Nasircilar, published by Polish Society for Horticultural Sciences (PSHS)
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.