Skip to main content
Have a personal or library account? Click to login
First characterisation of chrysanthemum virus B infecting chrysanthemum in Thailand and development of colourimetric RT-LAMP for rapid and sensitive detection Cover

First characterisation of chrysanthemum virus B infecting chrysanthemum in Thailand and development of colourimetric RT-LAMP for rapid and sensitive detection

Open Access
|Aug 2022

Figures & Tables

Table 1

Primers used for detection of CVB by RT-PCR and colourimetric RT-LAMP techniques in this study.

Type of detectionPrimer nameSequence (5′-3′)Target gene(s)Ta*** (°C)Reference
PCRCVB-F1
CVB-R1
AGTCACAATGCCTCCCAAAC
CATACCTTTCTTAGAGTGCTATGCT
TGB3** + CP54Guan et al. (2017)
PCR and sequencingCVB-up
CVB-dw
TAGGTTGTGGAGTGGTTACA
ATCTTCACAATGACATCCAT
CP56Lin et al. (2005)
LAMPFIP*
BIP
F3
B3
CCTGCTCACGCTCTCGTTCCCAGCTCGAACAGCGGAAG
AGATGAACTCCAATGCCCCAGCTAGTGCCGCGAGTTGTGT
ACCAACTCCACCTCCACC
TCGTCTTGCTCTCTCCTCAG
TGB3 + CP63–68This study

* FIP: forward inner primer containing F1c + F2.

** TGB3: triple gene block 3.

*** Ta: annealing temperature.

BIP, backward inner primer containing B1c + B2; B3, backward primer; CP, coat protein gene; CVB, chrysanthemum virus B; F3, forward primer; LAMP, loop-mediated isothermal amplification; PCR, polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction.

Figure 1

Symptoms observed on chrysanthemum leaves collected from Chiang Mai Province of Thailand that were positive to CVB detection by using RT-PCR. (A) Chlorosis and yellowing symptoms (the red arrow). (B) The mild mottling symptom. CVB, chrysanthemum virus B; RT-PCR; reverse transcription polymerase chain reaction.

Figure 2

Colour-coded pairwise identity matrix generated from 35 virus sequences consisting of CVB isolates, other members of the genus Carlavirus and CMV of the genus Cucumovirus that was used as the outgroup. CVB isolates in this study were indicated by red boxes. The pairwise identity matrix was performed in the SDT version 1.2 program. The colour of the cell indicates the percentage identity score between two sequences (left and bottom axis) according to the colour-coded cells mean to each cell in the SDT matrix of the Figure 2. CMV, cucumber mosaic virus; CVB, chrysanthemum virus B; SDT, sequence demarcation tool.

Figure 3

The phylogenetic relationship of CVB-BW-54 and CVB-HL4-70 (the red box) and members of the genus Carlavirus based on nucleotide sequences of the CP gene. CMV (accession №. AJ242585.1) was used as the outgroup. Multiple sequence alignments and construction of the phylogenetic tree were generated by ClustalW by the ML method with 1,000 replicates of bootstrap values performed by MEGA X program. CMV, cucumber mosaic virus; CP, coat protein; ML, maximum likelihood.

Table 2

Symptoms induced by CVB on indicator plants after mechanical inoculation.

Indicator plantsSymptoms
Inoculated leafUpper leaf
Chenopodium amaranticolorCS
C. quinoaCS
Chrysanthemum × morifoliumY
Nicotiana benthamianaM, Ma
N. glutinosaNS
N. tabacum cv. XanthiM, Ma
N. tabacum cv. SamsunNS
Petunia × hybridaM, Ma
Vigna uniculata

[i] CS: chlorotic spot; CVB, chrysanthemum virus B; M, mosaic; Ma, malformation; NS, necrotic spot; Y, yellowing; –, no symptom.

Figure 4

Diagram of LAMP primers’ attachment on the partial ORF4 (TGB3 gene) and ORF5 (CP gene) of CVB genome. All four LAMP primers including FIP (containing F2 and F2c), BIP (containing B2 and B1c), F3 and B3 were highlighted with different colours. BIP, backward inner primer; B3, backward primer; CVB, chrysanthemum virus B; FIP, forward inner primer; F3, forward primer; LAMP, loop-mediated isothermal amplification.

Figure 5

Optimisation of RT-LAMP for detection of CVB. (A) Optimisation of temperature at 60 °C, 63 °C, 65 °C and 68 °C for 60 min. (B) Optimising time of incubation at 65 °C for 30 min, 45 min and 60 min. CVB, chrysanthemum virus B; M, DNA ladder; NC, negative control (nuclease-free water).

Figure 6

Sensitivity test of LAMP in the detection of CVB compared with RT-PCR detection. (A) LAMP-AGE (top) with the LOD at 109 diluted plasmid and colourimetric LAMP (bottom). (B) PCR with LOD at 103 diluted plasmid. AGE, agarose gel electrophoresis; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; LOD, limits of detection; M, DNA ladder; NC, negative control (nuclease-free water); PCR, polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction.

Figure 7

Specificity assay and evaluation of colourimetric RT-LAMP for detection of CVB. (A) The LAMP product was observed only in the lane of CVB. (B) Evaluation of colourimetric RT-LAMP for detection of CVB from random chrysanthemum samples. (C) RT-PCR detection. CChMVd, chrysanthemum chlorotic mottle viroid; CSVd, chrysanthemum stunt viroid; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; Lanes 1–10, chrysanthemum samples; M, DNA ladder; MYSV, melon yellow spot virus; NC, negative control (nuclease-free water); PC, positive control; RT-PCR, reverse transcription polymerase chain reaction; TMV, tobacco mosaic virus; TuMV, turnip mosaic virus.

DOI: https://doi.org/10.2478/fhort-2022-0012 | Journal eISSN: 2083-5965 | Journal ISSN: 0867-1761
Language: English
Page range: 151 - 161
Submitted on: Mar 17, 2022
Accepted on: Jul 1, 2022
Published on: Aug 19, 2022
Published by: Polish Society for Horticultural Sciences (PSHS)
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year
Related subjects:

© 2022 Salit Supakitthanakorn, Tomofumi Mochizuki, Kanjana Vichittragoontavorn, Kaewalin Kunasakdakul, Pilunthana Thapanapongworakul, On-Uma Ruangwong, published by Polish Society for Horticultural Sciences (PSHS)
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.