First characterisation of chrysanthemum virus B infecting chrysanthemum in Thailand and development of colourimetric RT-LAMP for rapid and sensitive detection Cover

.blurhash-client-img { display: none !important; }

First characterisation of chrysanthemum virus B infecting chrysanthemum in Thailand and development of colourimetric RT-LAMP for rapid and sensitive detection

Folia Horticulturae

Volume 34 (2022): Issue 2 (December 2022)

By: Salit Supakitthanakorn , Tomofumi Mochizuki , Kanjana Vichittragoontavorn, Kaewalin Kunasakdakul, Pilunthana Thapanapongworakul and On-Uma Ruangwong

Open Access

|Aug 2022

Figures & Tables

Symptoms observed on chrysanthemum leaves collected from Chiang Mai Province of Thailand that were positive to CVB detection by using RT-PCR. (A) Chlorosis and yellowing symptoms (the red arrow). (B) The mild mottling symptom. CVB, chrysanthemum virus B; RT-PCR; reverse transcription polymerase chain reaction.

Colour-coded pairwise identity matrix generated from 35 virus sequences consisting of CVB isolates, other members of the genus Carlavirus and CMV of the genus Cucumovirus that was used as the outgroup. CVB isolates in this study were indicated by red boxes. The pairwise identity matrix was performed in the SDT version 1.2 program. The colour of the cell indicates the percentage identity score between two sequences (left and bottom axis) according to the colour-coded cells mean to each cell in the SDT matrix of the Figure 2. CMV, cucumber mosaic virus; CVB, chrysanthemum virus B; SDT, sequence demarcation tool.

The phylogenetic relationship of CVB-BW-54 and CVB-HL4-70 (the red box) and members of the genus Carlavirus based on nucleotide sequences of the CP gene. CMV (accession №. AJ242585.1) was used as the outgroup. Multiple sequence alignments and construction of the phylogenetic tree were generated by ClustalW by the ML method with 1,000 replicates of bootstrap values performed by MEGA X program. CMV, cucumber mosaic virus; CP, coat protein; ML, maximum likelihood.

Diagram of LAMP primers’ attachment on the partial ORF4 (TGB3 gene) and ORF5 (CP gene) of CVB genome. All four LAMP primers including FIP (containing F2 and F2c), BIP (containing B2 and B1c), F3 and B3 were highlighted with different colours. BIP, backward inner primer; B3, backward primer; CVB, chrysanthemum virus B; FIP, forward inner primer; F3, forward primer; LAMP, loop-mediated isothermal amplification.

Optimisation of RT-LAMP for detection of CVB. (A) Optimisation of temperature at 60 °C, 63 °C, 65 °C and 68 °C for 60 min. (B) Optimising time of incubation at 65 °C for 30 min, 45 min and 60 min. CVB, chrysanthemum virus B; M, DNA ladder; NC, negative control (nuclease-free water).

Sensitivity test of LAMP in the detection of CVB compared with RT-PCR detection. (A) LAMP-AGE (top) with the LOD at 10−9 diluted plasmid and colourimetric LAMP (bottom). (B) PCR with LOD at 10−3 diluted plasmid. AGE, agarose gel electrophoresis; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; LOD, limits of detection; M, DNA ladder; NC, negative control (nuclease-free water); PCR, polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction.

Specificity assay and evaluation of colourimetric RT-LAMP for detection of CVB. (A) The LAMP product was observed only in the lane of CVB. (B) Evaluation of colourimetric RT-LAMP for detection of CVB from random chrysanthemum samples. (C) RT-PCR detection. CChMVd, chrysanthemum chlorotic mottle viroid; CSVd, chrysanthemum stunt viroid; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; Lanes 1–10, chrysanthemum samples; M, DNA ladder; MYSV, melon yellow spot virus; NC, negative control (nuclease-free water); PC, positive control; RT-PCR, reverse transcription polymerase chain reaction; TMV, tobacco mosaic virus; TuMV, turnip mosaic virus.

Symptoms induced by CVB on indicator plants after mechanical inoculation_

Indicator plants	Symptoms

	Inoculated leaf	Upper leaf
Chenopodium amaranticolor	CS	–
C. quinoa	CS	–
Chrysanthemum × morifolium	–	Y
Nicotiana benthamiana	–	M, Ma
N. glutinosa	NS	–
N. tabacum cv. Xanthi	–	M, Ma
N. tabacum cv. Samsun	NS	–
Petunia × hybrida	–	M, Ma
Vigna uniculata	–	–

Primers used for detection of CVB by RT-PCR and colourimetric RT-LAMP techniques in this study_

Type of detection	Primer name	Sequence (5′-3′)	Target gene(s)	Ta^*** (°C)	Reference
PCR	CVB-F₁CVB-R₁	AGTCACAATGCCTCCCAAACCATACCTTTCTTAGAGTGCTATGCT	TGB3^** + CP	54	Guan et al. (2017)
PCR and sequencing	CVB-upCVB-dw	TAGGTTGTGGAGTGGTTACAATCTTCACAATGACATCCAT	CP	56	Lin et al. (2005)
LAMP	FIP^*BIPF3B3	CCTGCTCACGCTCTCGTTCCCAGCTCGAACAGCGGAAGAGATGAACTCCAATGCCCCAGCTAGTGCCGCGAGTTGTGTACCAACTCCACCTCCACCTCGTCTTGCTCTCTCCTCAG	TGB3 + CP	63–68	This study

DOI: https://doi.org/10.2478/fhort-2022-0012 | Journal eISSN: 2083-5965 | Journal ISSN: 0867-1761

Journal RSS Feed

Language: English

Page range: 151 - 161

Submitted on: Mar 17, 2022

|

Accepted on: Jul 1, 2022

|

Published on: Aug 19, 2022

Published by: Polish Society for Horticultural Sciences (PSHS)

In partnership with: Paradigm Publishing Services

Publication frequency: 2 issues per year

Keywords:

ornamental plant,

rapid detection,

virus detection,

Related subjects:

Life sciences, other

© 2022 Salit Supakitthanakorn, Tomofumi Mochizuki, Kanjana Vichittragoontavorn, Kaewalin Kunasakdakul, Pilunthana Thapanapongworakul, On-Uma Ruangwong, published by Polish Society for Horticultural Sciences (PSHS)
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Previous article Volume 34 (2022): Issue 2 (December 2022)Next article