GENETIC AND EPIGENETIC ANALYSIS IN COLORECTAL CANCER
Papasotiriou I1, Pisanidou V2, Serafeim A-P3, Beis G3, Hatzidaki E3, Apostolou P3
1Research Genetic Cancer Centre International GmbH, Baarerstrasse 95, Zug 6301, Switzerland
2General Hospital of Ptolemaida “Mpodosakeio”, Ptolemaida 50200, Greece
3Research Genetic Cancer Centre S.A., Florina 53100, Greece
Introduction: Colorectal cancer accounts for approximately 2 million cases every year worldwide, and more than 1 million related deaths. Early detection of the disease is of primary importance since mortality rates are reduced upon the involvement of screening programs. Identification of genetic and/or epigenetic patterns could contribute to early detection, prediction of treatment response, or progression of the disease. In this study, analysis was performed in circulating tumor cells from patients, suffering from colorectal cancer, both at the genetic and epigenetic levels.
Methods: A blood sample was collected from patients, representing colorectal cancer. Circulating tumor cells isolated from the above samples and array comparative genomic hybridization, as well as microarrays whole gene expression analysis followed. Blood was collected also from healthy individuals and similar assays were performed.
Results: Array CGH revealed patterns of specific cases, associated with X and Y chromosomes. The gene expression analysis led to the identification of a group of genes overexpressed only in cancer samples and not in normal individuals.
Conclusions: The study of circulating tumor cells, through genetic and epigenetic analysis, might be very useful in the identification of differential-expressed genes, or genetic patterns. These patterns could be used as screening or diagnostic tools. Despite the relatively small number of samples tested, the data are encouraging and further studies in more samples are needed, so to be used at a clinical level.
Keywords: colorectal cancer; genetics; epigenetic; circulating tumor cells
HRD/HRR NGS ANALYSIS IN 608 OVARIAN & PROSTATE CANCER SAMPLES
Samara S., Oikonomaki A., Roumelioti K., Christopoulou G., Constantoulakis P.
GENOTYPOS Science Labs, Athens, Greece
Introduction: Homologous Recombination Repair (HRR) pathway is a high-fidelity double-strand DNA breakage repair mechanism. Its deficiency is recently demonstrated as part of a mechanism for targeted therapy with PARP inhibitors (PARPi). Somatic mutations in HRR-associated genes and genomic instability (Loss Of Heterozygocity, Telomeric Allelic Imbalance, Large Rearrangements) consist biomarkers of HRR deficiency (Homologous Recombination Deficiency, HRD).
Aim: The purpose of this study is the detection of HRR/HRD-positive patients who could benefit from PARPi treatment, recently approved by the Food and Drug Administration (FDA) for these cancer types.
Methods: Samples from 338 ovarian cancer patients were tested for HRD (BRCA1/2 mutations and genomic instability) and from 270 prostate cancer patients for mutations in HRR genes, of which 124 for somatic (sHRR) and 146 for germline HRR mutations (gHRR). Libraries were prepared by AmoyDx® HRDFocus NGS Panel and AmoyDx® HANDLE HRR NGS Panel, respectively, and sequenced onNextSeq550 platform (Illumina) followed by bioinformatics analysis using ANDAS Data Analyzer (Amoy Diagnostics Co., Ltd.).
Results: Positive HRD score was detected in 49.4% of ovarian cancer patients (tBRCA: 7.2%, GSS score: 14.4% tBRCA+GS Sscore: 27.8%). Somatic mutations were detected in 42.4% of prostate cancer patients while actionable germline mutations were detected in 8.2%.
Conclusions: Studies have demonstrated that patients with HRD positive tumors may benefit from PARPi treatment. Timely and accurate selection of suitable candidates could be performed either by detecting the genetic cause (mutations in HRR genes)or the consequences (genomic instability). The methods we applied yielded results in concordance with published studies and are comparable to those of FDA approved companion diagnostic tests. Our experience highlighted the advantage of accessibility and short turn-around-times, using validated CE/IVD methods for the accurate evaluation of patients who could benefited from PARPi treatment. This approach constitutes a valuable diagnostic tool in the era of personalized medicine.
STUDY OF RESULTS AND SIDE EFFECTS OF LUNG INTRALUMINAL BRACHYTHERAPY
Seretis A.1, Vasilakou E.1, Karelaki C.1, Pappas N.1, Gerogiannis S.1, Gialousis G.2, Koukorava X.2, Betsou S.2, Zettos A.3, Bisirtzoglou D.3, Papalla K.1
1Radiation Oncology Department -”St Savvas” Anticancer Hospital
2Department of Radiophysics -”St Savvas” Anticancer Hospital
3Pulmonology Department -”St Savvas” Anticancer Hospital
Introduction: Lung cancer, despite the progress of treatment interventions, still remains a disease with relatively poor prognosis. Approximately 80–85% of cases are Non Small Cell Lung Cancer(NSCLC). Adenocarcinoma and Squamous Cell Carcinoma are responsible for the majority of NSCLC. Surgery offers the best treatment options.75% of patients present with locally advanced non-resectable disease. For these patients, chemotherapy and/or external beam radiotherapy is the treatment of choice, with low survival rates and high rates of local recurrence.
Aim: The purpose of this study is to investigate the immediate relief of obstructive symptoms.
Methods: Endobronchial brachytherapy is now an established method for relieving symptoms in advanced Non Small Cell Lung Cancer, with endobronchial relapse after radiotherapy. It is used for intraluminal tumours, alone or in combination with external beam radiotherapy and chemotherapy. Today it is applied in combination with external beam radiotherapy in selected primary bronchial and tracheal tumors. Brachytherapy is a method that is gaining ground as a curative and/or palliative therapy, in both primary and metastatic intraluminal tumors. High dose rate radiation is used with a relatively easy application process. The treatment is done in two applications, one per week x8 Gy.
Results: The clinical results and side effects, short-term and long-term, were studied in different cases, metastatic with complete obstruction and primary with complete obstruction and bleeding, with clinical improvement within the first 24 hours.
Conclusions: Lung cancer brachytherapy is an integral part of palliative treatment of lung cancer with dyspnea due to airway obstruction, with immediate clinical results.
EVALUATION OF DJ-1 AND PTEN BIOMARKERS IN ONCOLOGY PATIENTS BEFORE AND AFTER IMMUNOTHERAPY
Kantzioura A.2, Tasioulis K.1, Papi R.1, Choli-Papadopoulou T.1, Nikolakaki E.1, Adamidis A.3
1Laboratory of Biochemistry, Department of Chemistry, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
2SecondMedical Oncology Department, Theagenio Cancer Hospital, 54007 Thessaloniki, Greece, Hellenic Society of Oncologists
3Agios Loukas Clinic, 55236 Thessaloniki, Greece, Hellenic Society of Oncologists
Introduction: The “multifaceted” approach through interdisciplinary methodologies that combine cognitive objects such as physics, materials science, nano-biotechnology, etc., opens new horizons and new paths for the preparation of compounds in nanoscale and for the effective targeting of new biomolecules. Two proteins, a tumor suppressor protein PTEN (the phosphatase and TENs in homolog deleted on chromosome 10) and DJ / PARK7 protein (increased expression of both mRNA and DJ-1-produced oncogenic protein in various types of cancer), are investigated in patient serum before and after immunotherapy to correlate their protein production.
Aim: The purpose of this experimental study is to investigate the loss of activity of PTEN in relation to its phosphorylation, a phenomenon in which the DJ-1 protein is involved, as well as the correlation of their levels with the response to immunotherapy, prognosis, and survival of patients.
Methods: In this study, serum samples were taken from 42 oncology patients with different primary localization, histological type, and degree of tumor differentiation before and during immunotherapy (3 months after the onset of immunotherapy). PTEN and P-PTEN (Ser380) biomarkers were determined by Western blotting and DJ-1 by ELISA, but firstly total serum proteins had been determined by the Bradford method.
Results: Between the levels of PTEN, P-PTEN and DJ-1, a correlation was observed in the different types of cancer both with each other and in relation with immunotherapy as well as with the stage of the disease and its final outcome.
Conclusion: PTEN, P-PTEN and DJ-1 could be further investigated for their use as biomarkers of responses to immunotherapy as well as prognostic markers for various types of cancer.

Figure 1
The variation of PTEN, P-PTEN and DJ-1 biomarker levels in oncology patients before and during immunotherapy depends on the corresponding levels in healthy adults.

Figure 2
The variation of the DJ-1 biomarker levels regarding the histological type of the cancer before and after performing immunotherapy.

Figure 3
The variation of the levels of the PTEN biomarker regarding the histological type of the neoplasm before and after performing the immunotherapy.

Figure 4
The variation of P-PTEN biomarker levels with respect to the histological type of the neoplasm prior and during immunotherapy.

Figure 5
The variation of PTEN, P-PTEN AND DJ1 biomarker levels with respect to sex in cancer patients and healthy adults.
TESTING OF NEWLY DIAGNOSED ADVANCED HIGH GRADE OVARIAN CANCER (OC) PATIENTS WITH THE MYRIAD GENETICS MYCHOICE® CDX PLUS NEXT GENERATION SEQUENCING-BASED IN VITRO DIAGNOSTIC TEST EMPHASIZES THE NEED FOR PUBLIC INSURANCE COVERAGE OF GENETIC TESTING: RESULTS OF A NATIONAL PROGRAM BY THE HELLENIC SOCIETY OF MEDICAL ONCOLOGY (HESMO)
Liontos M, Timotheadou E, Saloustros E, Koumarianou A, Athanasiadis I, Karageorgopoulou S, Papakotoulas P, Syrios J, Kesisis G, Papadimitriou C, Biziota E, Skondra M, Giassas S, Kampletsas E, Peroukidis S, Christodoulou C, Kantzioura A, Nikolaou M, Papaxoinis G, Soupos N, Fotarelli A, Emmanouilidis C, Kotsakis A, Mavroudis D, Bokas A, Stamatopoulou S, Tolis C, Mauri D, Anagnostopoulos A, Georgoulis V, Korantzis I, Koutras A, Koutsoukos K, Papadopoulos G, Papanikolaou S, Pouptsis A, Romanidou O, Touroutoglou N, Tsiara A, Floros T, Agorastos T, Adamidis A, Andreadis C, Andreadou A, Gouveris P, Demiri S, Kalykaki A, Kanaloupiti D, Kapodistrias N, Makatsoris T, Mountzios I, Botsolis K, Nasi D, Ntouvelis E, Xanthakis I, Oikonomopoulou P, Papazisis K, Perdikouri E-I, Pispirigou M, Pliarchopoulou K, Razis E, Rallis G, Rapti K, Stamati D, Stefanou D, Tzaninins D, Tryfonopoulos D, Fassas A, Fountzila E, Charalampakis N, Chatsidis G, Christopoulou A, Aravantinos G, Ardavanis A, Efthymiadis K, Zagouri F, Zakopoulou R, Zarkavelis G, Zafeiriou Z, Ziogas D, Zlatintsi T, Thomopoulou K, Kalofonos C, Kaltsas S, Karanikiotis C, Katopodi O, Kosmas C, Kosmidis P, Kourousis C, Kostadima L, Lampropoulos S, Laschos K, Levva S, Lianos E, Makrantonakis P, Maragos C, Mitsimponas N, Michalaki V, Barmpounis V, Bafaloukos D, Boutis A, Neanidis K, Nikiforidis L, Nikolakopoulos A, Ntoufexis D, Oikonomopoulos G, Orfanos G, Panou M, Papanastasopoulos P, Papafili A, Paraskeva M, Pektasidis E, Petrakis D, Rigakos G, Rigas G, Spathas N, Sfika A, Tegos T, Tzovaras A, Tripodaki E-S, Tsoukalas N, Papageorgiou F, Boukovinas I, Saridaki Z
On behalf of the Hellenic Society of Medical Oncology (HeSMO)
Aim: Homologous Recombination deficiency represents a distinct entity in OC. Clinical data suggest that treatment selection can also consider beyond BRCA1/2 carriers those bearing Genomic Instability. Therefore, testing for GIS is critical to expand patients’ pool for targeted treatment. Myriad my Choice, is currently the only FDA approved test that can detect Homologous Recombination Deficiency (HRD) by assessing BRCA1/BRCA2 Status, and the Genomic Instability Status (GIS) in tumor using three critical biomarkers: loss of heterozygosity, telomeric allelic imbalance and large-scale state transitions. To address this need, HeSMO has initiated a national program to provide access to myChoice to those newly diagnosed patients with high grade stage III/IV OC.
Methods: All patients with newly diagnosed stage III/IV high grade OC were eligible to participate in this program. The specific performance characteristics of the myChoiceCDx assay were determined by studies using FFPE tumor samples. Samples were selected to evaluate a range of representative tumor BRCA1 and BRCA2 sequence variants (e.g. single nucleotide variants, insertions or deletions and variants in homopolymers) and Large Rearrangements (e.g. deletions and duplications affecting single and multiple exons) detected by the myChoiceCDx assay, as well as a representative range of GIS. The overall results are composed of two major components, GIS Status (positive or negative) and tBRCA1/2 Status (positive or negative). The combined results form the basis of the overall interpretation of the myChoiceCDx Myriad HRD Status.
Results: From December 2020 to January 2022, 454 patients from all over the country were tested within this program. 220 patients (48.46%) had a positive GIS report and 179 (39.43%) had a negative one. Among Count GIS positive cases, 122 patients were tBRCAwt (26.87%) 78 patients were tBRCAm (17.18%) and 10 patients had suspected deleterious BRCA1/2 mutations (2.20%). Inconclusive was the report in 38 specimens (8.37%) and myChoice Lab failed to complete the analysis in 15 cases (3.30%). Furthermore, mutations were also detected in a number of other genes, including but not limited to, ATM, BRIP1, PALB2, RAD51C, RAD51D, FANCL, CHEK2.
Conclusions: In our series, 48.46% of the patients with high grade OC tested as BRCA1/2 and/or GIS positive, in accordance with published data, underlying the clinical need to implement GIS testing in OC patients’ molecular evaluation. Apart from the significant implications for treatment possibilities in an expanded patients’ population, these results are also important for cancer prevention. We strongly believe that our results will strengthen our efforts for reimbursement of such testing in high grade OC patients, and will serve as a roadmap for the establishment of local HRD testing solutions.
APPLICATION OF NGS TECHNOLOGY IN SARCOMAS’ DIAGNOSIS. ISSUES AND CONCLUSIO9N OF NGS USE IN THE CONTEXT OF A PUBLIC HEALTH CARE SYSTEM PROVIDER
Mahaira L., Konteles V., Dimitriadis E.
Department of Genetics, “St.Savvas” Anticancer Hospital
Introduction: The majority of tumors of mesenchymal origin (mainly sarcomas) is characterized by the presence of chimeric genes. The detection and identification of these genes has become an essential part of these tumors ‘ diagnosis. RT-PCR and FISH analysis are the most widely used technique up to now. During the last decade evolution in NGS technology offered an alternative application for fusion genes identification. However, up to now, the commercially available kits specific for sarcomas are extremely few and have significant limitations.
Aim: The goal of this study is to present the findings of NGS application in sarcomas diagnosis using a panel designed in our lab.
Methods: NGS analysis was performed on an Ion Gene Studio S5 (Thermo Fisher Scientific). Using published data and known sequences as well as the Ion Designer Suite, we designed a panel that includes 82 different fusion products instead of 62 that were initially included in a Thermo Fisher Research panel. This new, in-house designed, panel covers 40 different histological types of mesenchymal tumors.
Results: Until today, 143 samples have been analyzed using this new panel. Among these, 10 samples were excluded due to degraded starting material. Fusion genes were detected in 38/133 samples, and EWSR1/FLI1 was the most commonly identified fusion. Samples were received, analyzed and results were presented to clinicians in a median period of 2–3 weeks.
Conclusions: NGS technology can and should be incorporated in sarcomas’ diagnostic workflow. The only obstacle that should be bypassed is the quality of the starting material sent for analysis.
DIFFERENT COPY NUMBER VARIATIONS (CNVS) ACCOUNT FOR 10.7% OF PATHOGENIC VARIANTS IN 2163 PATIENTS REFERRED FOR HEREDITARY CANCER TESTING
Agiannitopoulos K.1, Pepe G.1, Papadopoulou E.1, Tsaousis G.N.1, Apostolopoulou D.1, Tsoulos N.1, Potska V.1, Venizelos V.2, Markopoulos C.3, Iosifidou R.4, Vasilaki-Antonatou M.5, Christodoulou C.2, Natsiopoulos I.6, Papazisis K.7, Kabletsas E.8, Psyrri A.9, Karageorgopoulou S.10, Giassas S.11, Ziogas D.11, Lalla E.4, Koumarianou A.9, Papadimitriou C.12, Trafalis D.13, Timotheadou E.14, Nasioulas G.1
1 Genekor Medical S.A, Athens, Greece
2 Metropolitan Hospital, Athens, Greece
3 Athens Medical Center, Athens, Greece
4 Theagenio Anticancer Hospital, Thessaloniki, Greece
5 Metropolitan General Hospital, Athens, Greece
6 Interbalkan Medical Center of Thessaloniki, Thessaloniki, Greece
7 Euromedica General Clinic, Thessaloniki, Greece
8 University Hospital of Ioannina, Ioannina, Greece
9 Attikon University Hospital, Athens, Greece
10 IASO, General Maternity and Gynecology Clinic, Athens, Greece
11 General Hospital of Athens “LAIKO”, Athens, Greece
12 Alexandra Regional General Hospital, Athens, Greece
13 Mediterraneo, Athens, Greece
14 University Hospital “Papageorgiou” Thessaloniki, Greece
Introduction: Hereditary Cancer Syndromes play a major role in about 5–10% of all cancers and are associated with the presence of inherited variants in specific genes. Copy number variations (CNVs) are a type of variants associated with inherited cancer. Nowadays, Next Generation Sequencing (NGS) technology has contributed to the analysis of many genes and is used in clinical practice to analyze CNVs.
Aim: Detection of CNVs in cancer patients using SeqPilot software (JSI Medical Systems) and panelcn. MOPS algorithm.
Methods: A total of 2163 patients (1785 with breast cancer, 267 with ovarian cancer and 111 with colorectal cancer) were tested for cancer predisposition by analyzing 43 genes using NGS and performing bioinformatics analysis of CNVs.
Results: The 10.7% (50/464) of all pathogenic/likely pathogenic variants were CNVs. In patients with breast cancer and ovarian cancer at least one pathogenic/likely pathogenic variant was detected in 362 (20.3%) and 74 (27.7%) of patients and CNVs accounted for 10.2% (37/362) and 6.7% (5/74), respectively. In patients with colorectal cancer CNVs accounted for 28.6% (8/28) of pathogenic/likely pathogenic variants. Among the 50 CNVs detected 72% were detected in high-risk cancer genes (50% BRCA1, 2% BRCA2, 8% PMS2, 6% MLH1, 6% MSH2), 20% in moderate-risk cancer genes (16% CHEK2, 4% ATM) and 8% in a low-risk cancer gene (8% FANCA). The confirmation of the findings with the MLPA technique showed that use of computational algorithms for CNV detection have 100% sensitivity and specificity.
Conclusions: Genetic testing in hereditary cancer is recommended to include full gene length sequencing as well as analysis of CNVs, contributing to medical management decisions for patients, as shown by the high percentage of CNVs among the positive findings. In addition, CNVs detect algorithms provide a cost-effective and feasible methodology for their determination from NGS data.
APPLICATION OF NGS TECHNOLOGY IN SARCOMAS’ DIAGNOSIS. ISSUES AND CONCLUSIO9N OF NGS USE IN THE CONTEXT OF A PUBLIC HEALTH CARE SYSTEM PROVIDER
Mahaira L., Konteles V., Dimitriadis E.
Department of Genetics, “St.Savvas” Anticancer Hospital
Introduction: The majority of tumors of mesenchymal origin (mainly sarcomas) is characterized by the presence of chimeric genes. The detection and identification of these genes has become an essential part of these tumors ‘diagnosis. RT-PCR and FISH analysis are the most widely used technique up to now. During the last decade evolution in NGS technology offered an alternative application for fusion genes identification. However, up to now, the commercially available kits specific for sarcomas are extremely few and have significant limitations.
Aim: The goal of this study is to present the findings of NGS application in sarcomas diagnosis using a panel designed in our lab.
Methods: NGS analysis was performed on an Ion Gene Studio S5 (Thermo Fisher Scientific). Using published data and known sequences as well as the Ion Designer Suite, we designed a panel that includes 82 different fusion products instead of 62 that were initially included in a Thermo Fisher Research panel. This new, in-house designed, panel covers 40 different histological types of mesenchymal tumors.
Results: Until today, 143 samples have been analyzed using this new panel. Among these, 10 samples were excluded due to degraded starting material. Fusion genes were detected in 38/133 samples, and EWSR1/FLI1 was the most commonly identified fusion. Samples were received, analyzed and results were presented to clinicians in a median period of 2–3 weeks.
Conclusions: NGS technology can and should be incorporated in sarcomas’ diagnostic workflow. The only obstacle that should be bypassed is the quality of the starting material sent for analysis.
HYPOFRACTIONATED RADIOTHERAPY IN PATIENTS OF FOURTH AGE WITH NON MELANOMA SKIN CANCER (NMSC)
Karelaki C., Vasilakou E., Seretis A., Pappas N., Karagianni P., Gerogiannis S., Papalla K.
Radiation Oncology Clinic, General Anti-Cancer Oncology Hospital ‘Saint Savvas’, Athens, Greece
Introduction: Radiation therapy is an important tool in the treatment of non-melanoma skin cancers (NMSCs), mainly squamous cell carcinomas (SCC) and basal cell carcinomas (BCC), for elderly patients undergoing surgical resection of the tumor, or even those who cannot undergo surgery due to advanced age and comorbidity. The fourth age refers to patients over the age of 80, usually with multiple health problems
Aim: With this study we would like to highlight the therapeutic benefit of hypofractionated radiotherapy in combination with its toxicity in elderly patients with PS: 3–4 at the ECOG classification. Also the ambulatory problems of these patients become an obstacle for regimens of 6–7 weeks and increased toxicity is observed.
Methods: In the Radiotherapy Department of ‘Saint Savvas’ Hospital, 30 cases of patients aged 80–97 years presented with advanced local non-melanoma skin cancer of therapeutic stage T3-T4 from January 2021-December 2021. They were treated with hypofractionated radiotherapy regimen of total dose of 50 Gy with daily dose of 2.5 Gy in multiple phases. 3% (19/30) of the patients had undergone surgical resection and had a relapse and 36.7% (11/30) were treated exclusively with radical radiotherapy. Of the above cases, 83.3% (25/30) were associated with SCC, while 16.6% (5/30) were related to BCC.
Results: The mean age of patients was 88 years old. All cases showed radiodermatitis and mucositis GI-GIII by ECOG, which were treated with conservative treatment. None of the patients discontinued treatment, 23.3% (7/30) of them did not follow the complete re-examination while the remaining 76.6% (23/30) had a good response to the regular re-examination in the last 6 months. 80% (24/30) had complete remission of the disease after the first re-examination (3 months after treatment) with complete remission of local side effects within 2–3 weeks after radiotherapy.
Conclusions: The treatment regimens showed impressive results with good tolerance to radiotherapy in elderly patients.
PREVENTION OF VENOUS THROMBOEMBOLISM IN AMBULATORY PATIENTS WITH ACTIVE CANCER: RESULTS FORM THE ACT4CAT TRIAL
Tsoukalas N., Christopoulou A., Koumarianou A., Timotheadou E., Athanasiadis I., Samelis G., Peroukidis S., Psyrri A., Kapodistrias N., Nikolakopoulos A., Demiri S., Andreadis Ch., Bokas A., Tripodaki E-S., Ardavanis A., Samantas E., Papandreou Ch., Kalofonos Ch., Mavroudis D., Kentepozidis N., Barbounis V., Anastopoulou G., Arvanitou E., Gkikas K., Papadopoulou P., Nikolaidi A., Kampoli A., Katsouli E., Dimitriadou A., Golfinopoulos S., Assi A., Mouzakiti A., Tzimou M., Perdikari K.-Ch., Giannakou M., Litos I., Sofatzis I., Mala A., Michas A., Binas I., Thalassinou P., Loulias N., Ardavanis-Loukeris G., Volakakis N., Athanasiadis A., Papakotoulas P., Boukovinas I.
On behalf of the Hellenic Society of Medical Oncology (HeSMO, http://www.hesmo.gr/en), Athens, Greece
Aim: Venous thromboembolism (VTE) might be a challenge with a lot of negative consequences for patients with active cancer. VTE affects ongoing anticancer treatment, worsening morbidity and mortality, increases economic burden and escalates psychological distress. Incidence of VTE in patients with cancer reported 20%. Current guidelines recommend pharmacologic prophylaxis in ambulatory cancer patients with Khorana score ≥2
Methods: ACT4CAT is a prospective observational phase IV study conducted by HeSMO Greece, aiming to record the clinical practice of VTE prophylaxis in active cancer patients. Ambulatory oncology patients who received thromboprophylaxis enrolled after signing informed consent. The study was approved by the bioethics committee.
Results: 691 patients from 19 oncology departments administered thromboprophylaxis, their therapeutic lines were: 1st line 57.6%, 2nd line 14.8%, adjuvant 9.0% and neoadjuvant 7.5%. Tumor types: gastrointestinal 45.4%, lung 25.8%, urological 11.6%, gynecological 6.0%, breast4.2% and others 7.0%. Age ≥65 found at 55% of patients, BMI≥30 at 17.5% and males were 63%. High-Risk for Thrombosis Agents (HRTAs) received at 87.2%, specifically: platinum agents (56.3%), antimetabolites (54.2%) and immunotherapy (12.1%). 54,5% of the anticancer agents had potential drug-drug interactions (DDIs)with anticoagulation treatment. Thrombosis risk factors in % presented in table per tumor type.
| Primary tumor | Incidence | Gender (female) | Age≥65 | BMI≥30 | Smoking | Khorana score ≥2 | Metastatic | HRTAs | DDIs |
|---|---|---|---|---|---|---|---|---|---|
| Pancreas | 27.2 | 40.9 | 54.0 | 11.2 | 49.2 | 100.0 | 76.7 | 96.8 | 63.1 |
| Lung | 25.8 | 22.3 | 57.6 | 19.2 | 88.1 | 60.5 | 88.5 | 89.3 | 58.2 |
| Stomach | 7.1 | 23.8 | 57.1 | 14.3 | 61.2 | 98.0 | 65.9 | 89.8 | 32.7 |
| Urological | 11.6 | 9.5 | 66.3 | 22.5 | 71.3 | 26.3 | 69.3 | 66.3 | 47.5 |
| Rectal | 11.1 | 37.3 | 59.2 | 11.8 | 47.4 | 21.1 | 85.5 | 93.4 | 30.3 |
| Breast | 4.2 | 96.2 | 24.1 | 17.2 | 34.5 | 17.2 | 73.1 | 62.1 | 65.5 |
| Ovarian | 4.1 | 100.0 | 60.7 | 25.0 | 28.6 | 67.9 | 76.9 | 85.7 | 78.6 |
| Corpus uterus | 1.2 | 100.0 | 62.5 | 62.5 | 25.0 | 62.5 | 83.3 | 62.5 | 87.5 |
| Cervix uterus | 0.7 | 100.0 | - | - | 80.0 | 80.0 | 80.0 | 100.0 | 100.0 |
| Other | 7.0 | 32.4 | 43.8 | 29.2 | 66.7 | 4.2 | 64.7 | 83.3 | 50.0 |
Thromboprophylaxis duration lasted 5.3±3.5 months. Main agents were: tinzaparin 89.6%, fondaparinux 6.0%, bemiparin 2.2%, enoxaparin 1.6%, apixaban 0.3% and rivaroxaban 0.3%. Intermediate thromboprophylaxis doses received from 68% of patients, less in adjuvant setting (45.2%), with a preference in metastatic cases (OR:1.5 95%CI:1.02–2.3, p=0.026). 14 thrombotic events reported (efficacy: 98.0%, 95%CI: 96.6–98.8%) and 12 grade 1 bleeding events(1.7%, 95%CI:1.0–3.0%).
Conclusions: Prevention of venous thromboembolism in ambulatory patients with active cancer found to be effective and safe. Apart from the Khorana score, specific patient characteristics, metastasis, HRTAs and DDIs seemed that affect the clinical decision for thromboprophylaxis mainly with LMWHs and often on intermediate doses regardless the clinical setting. Oncologists appeared to be informed that CAT is not negligible risk and try to protect their patients with thromboprophylaxis.
PROGNOSTIC SIGNIFICANCE OF LOW HER2 EXPRESSION IN PATIENTS WITH EARLY HORMONAL RECEPTOR POSITIVE BREAST CANCER
Douganiotis G.1, Kontovinis L.2, Markopoulou E.2, Ainali A.2,3, Zarampoukas Th.4, Natsiopoulos I.3, Papazisis K.2,3
13rd Department of Medical Oncology, Theagenio Cancer Hospital, Thessaloniki, Greece
2Medical Oncology Department, Euromedica General Clinic, Thessaloniki, Greece
3Breast Cancer Center, Interbalkan European Medical Center, Thessaloniki, Greece
4Department of Pathology, Interbalkan European Medical Center, Thessaloniki, Greece
Introduction: The current classification of breast cancer is based on the assessment of Hormonal Receptors and HER2 expression via immunohistochemistry (IHC). According to HER2 expression, tumors are classified as HER2-positive (IHC +3, +2 with positive in situ hybridization - ISH) and HER2-negative (IHC 0, +1, +2 with negative ISH). New data have revealed significant heterogeneity in the group of HER2-negative tumors, and have shown that low expression of HER2 has predictive and possibly also prognostic significance, although this phenomenon is still under examination.
Methods: Data from the medical records of Oncomedicare were retrospectively collected from 2007 to 2021. The analysis included all patients with early Hormonal Receptor-positive HER2-negative breast cancer, who had completed their initial treatment and had started hormonal treatment and for whom data were available in a certified pathology laboratory regarding the precise immunohistochemical expression of HER2. The duration of Recurrence-Free Survival (RFS) was recorded in the study population, and additional stratification was performed according to the presence of lymph node disease (N+) or not (N−).
Results: A total of 949 patients with HR-positive HER2-negative breast cancer were included in the analysis. Median age at diagnosis was 51 years, with a median follow-up of 2.8 years. 297 patients were N+, 645 were N−, and 7 did not have (N) staging. HER2 expression was not prognostic for recurrence free survival. Stratification according to N stage showed a lack of prognostic significance of HER2 expression both in N+ and in N− patients. In the N+ patients, HER2 expression of +2 showed a trend towards increased risk of recurrence compared to HER2 (0), but this was not statistically significant (HR=1.512, 95% CI 0.6315–3.620). In lobular or mixed ductal/lobular tumors, low HER2 expression showed a trend towards increased risk of recurrence compared to HER2 (0), which was also not statistically significant (HR=2.192, 95% CI 0.819–5.912).
Conclusions: Low HER2 expression in patients with early Hormonal Receptor positive breast cancer was not prognostic for recurrence-free survival in this study. RFS according to HER2 expression

RFS according to HER2 expression

N- patients

N+ patients

Patients with ductal carcinoma

Patients with lobular / mixed ductal&lobular carcinoma
THROMBOPROPHYLAXIS IN LUNG CANCER PATIENTS WITH TINZAPARIN: RESULTS FROM THE INVESTIGATION ON CANCER & LUNG THROMBOPROPHYLAXIS - THE ICALT STUDY
Kouvela M., Grammoustianou M., Sarropoulou F., Tsamis I., Gomatou G., Gkiozos I., Nikolaidou B., Kotteas E., Syrigos K.N.
Oncology Unit, 3rd Internal Medicine Department, Medical School, University of Athens, “Sotiria” Hospital Athens, Greece
Aim: It is known that malignancies exaggerate the risk of thrombosis up to 20%, while for Lung Cancer (LC) is articulated up to 14%. Likewise, thrombosis amplifies the LC progression, thrombosis-associated lung cancer (TALC). The pathophysiology promoting LCAT & TALC is multifactorial depending on the characteristics of LC, specific anti-cancer modalities, patient features, and several biomarkers. Low-molecular-weight heparins are used in prophylaxis and treatment for high-burden for thrombosis (HTB) patients, allowing specialists to focus on the cancer disease.
Methods: iCaLT is a prospective observational study assessing the role of thromboprophylaxis with tinzaparin 10.000 Anti-Xa IU, OD with the systemic anti-cancer therapy (SACT). LC patients with active disease and high thrombotic risk that are currently under treatment receive prophylactic dose of tinzaparin and are monitored up to six months or until treatment line terminates.
Results: Results from 106 patients reported 79% were males. Histological results involve: adenocarcinomas 54%, squamous 25%, small cell 15% and others. On average patients accumulated 3.7±1.1 risk factors, 91% of patients accumulated ≥3 risk factors. Median thromboprophylaxis duration was: 4.8 months. One patient experienced thrombotic event (efficacy 99.1%, 95%CI: 94.6–99.8%), five patients experienced minor bleeding adverse events (haemoptysis) (4.7%, 95%CI: 2.0–10.6%), and two patients allergic reactions. Patients with haemoptysis had lower age (60 vs. 67, p=0.1357).
Conclusions: Thromboprophylaxis with tinzaparin intermediate dose in high thrombotic risk patients with active lung cancer is effective and safe. Further research is needed.
COMPARATIVE STUDY OF CHEMOTHERAPY COST FOR BREAST AND PANCREATIC CANCER OF TWO SEPARATE YEARS AT HIPPOCRATION HOSPITAL OF ATHENS (BEFORE AND AFTER EOPYY ORGANIZATION ESTABLISHMENT)
Tsingouni A1., Toutouzas K2.
1Master of Science “Surgical Oncology” UOA-“Hippocratio” General Hospital of Athens,
2First Department of Propaedeutic Surgery UOA-“Hippocratio” General Hospital of Athens
Introduction: Objective of this study is to compare the cost of chemotherapy drugs for breast and pancreatic cancer at the General Hospital of Athens “Hippocratio” for two individual years, in 2007, before the beginning of the economic crisis in Greece and in 2016, after the country entered the memorandum. The cost includes supportive antiemetic treatment.
Aim: Comparison of chemotherapy cost for breast and pancreatic cancer in different national economic conditions, 2007 & 2016 with restricted prescription, establishment of EOPYY organization and control mechanisms of pharmaceutical cost, such as the portion of original/generic drugs and the national oncology guidelines. Aim is to identify the cost variation and to evaluate the impact of crisis.
Methods: Retrospective data collection from hospital IT department. The file including all patients data and invoicing cost, was processed, categorized based on the diagnosis and analyzed accordingly.
Results: Hospital budget is higher for 2016 (2007: 111,188,344.18 € <2016: 115,624,891.36 €). Pharmacy budget is almost the same (2007: 15,400,000.00 € & 2016: € 15,440,000.00). In 2016, breast cancer chemotherapy cost is lower. The cost per patient decreased 3.5%. The number of patients was reduced by 5% although the portion of men was increased by 0.7%. The cost per session decreased by 1.6%, while the average number of sessions remained stable at 7. The average age changed from 61 to 59.8 years. Pancreatic cancer chemotherapy cost is higher for 2016, while the cost per patient was reduced by 43%. The number of patients increased by 54% with an increase of 16.7% for women. The average age of patients reached 65.5 from 64 years. The cost per session was recorded 57.3% lower. The average number of sessions per patient increased from 7 to 9 treatments.
| CHEMOTHERAPY COST | COST PER PATIENT | NUMBER OF PATIENTS | COST PER SESSION | AVG No SESSIONS | AVG AGE | ΓYNAIKEΣ WOMEN | AAAAAA MEN | ||
|---|---|---|---|---|---|---|---|---|---|
| BREAST CANCER | 2007 | 1.597.695,04 € | 10.442,45 € | 153 | 1.316,06 € | 7 | 61 | 151 | 2 |
| 2016 | 1.460.909,35 € | 10.075,24 € | 145 | 1.295,13 € | 7 | 59,8 | 142 | 3 | |
| PANCREATIC CANCER | 2007 | 248.681,69 € | 5.920 € | 42 | 826,19 € | 7 | 64 | 13 | 29 |
| 2016 | 306.121,73 € | 3.327,41 € | 92 | 352,67 € | 9 | 65,5 | 43 | 49 |
Conclusions: In 2016, total hospital budget was higher compared to 2007 while at the same time pharmacy budget remained stable. Breast cancer chemotherapy cost was slightly decreased and so did the number and average age of patients. Concerning pancreatic cancer treatment, significant decrease of chemotherapy cost per patient (43%) was recorded. At the same time the total number of patients was increased (54%) and the average number of chemotherapy sessions per patient changed from 7 to 9. The portion of female patients was also increased.
OVARIAN CANCER IN GREECE: A RETROSPECTIVE STUDY OF 1,470 PATIENTS TREATED IN ALEXANDRA UNIVERSITY HOSPITAL
Andrikopoulou A., Zagouri F., Kaparelou M., Koutsoukos K., Markellos C., Skafida E., Papatheodoridi A.M., Dimopoulos M.A., Liontos M.
Department of Clinical Therapeutics, Alexandra University Hospital, National and Kapodistrian University of Athens, Greece
Introduction: Globally, ovarian cancer is the seventh most common cancer in women and the eighth most common cause of cancer death. Despite initial high response rates to chemotherapy, most patients eventually relapse and 75% of stage III/IV patients die within 5 years.
Aim: To provide real-world data on prognosis and treatment of patients with stage III/IV ovarian cancer treated in Greece.
Methods: We retrospectively recorded the clinicopathological characteristics of ovarian cancer patients treated in the Hematology-Oncology Unit of Clinical Therapeutics Department of University of Athens in Alexandra General Hospital. Between January 1994 to December 2018, 1470 ovarian cancer patients were diagnosed, treated and followed up in our Department which has been certified by the European Society of Gyenocologic Oncology (ESGO) as a center of excellence for the treatment of ovarian cancer. All women had provided informed consent for their treatment as well as for their use of medical records for research purposes. Clinicopathological characteristics recorded include age at diagnosis, stage and histology of the disease, primary or interval debulking surgery, residual disease at IDS, BRCA mutation status, progression-free survival and overall survival.
Results: Median age of diagnosis was 59 years. About 75% of patients were diagnosed with advanced disease (III/IV), including 54,7% (774/1416) of stage IIIC patients and 14,7% (208/1416) of stage IV patients. Serous ovarian carcinomas accounted for 63% of overall ovarian patients, while endometrioid and clear cell carcinomas consisted the 11,5% and 8% of ovarian tumors respectively. Collectively, all epithelial ovarian tumors composed approximately the 90% of the overall population. 83,7% of patients demonstrated a performance status of ECOG 0/1. The majority of patients (85,7%) underwent a primary debulking surgery in contrast with 8,5% who underwent an interval debulking surgical intervention. Diagnosis of the remaining 5,7% was based on laparoscopic biopsy or cytologic examination of ascitic/pleural fluid. Among 989 (67,3%) of patients with available recurrence date, median PFS was 38 months. Stage IIIC/IV ovarian cancer patients exhibited a median PFS of 27 months that was significantly lower than that of the overall population. Median OS was 52 and 42 months for the overall and stage IIIC/IV patients respectively. Among 92 patients that were tested for BRCA, 29,3% (27/92) of patients were BRCA-mutant in contrast with 70,7% (65/92) BRCA-wild type patients, although BRCA germline/somatic testing was not performed before 2005 and was rarely performed before 2010. Therefore, our study size remains limited regarding BRCA mutation status.
Conclusions: These are the preliminary results of the epidemiological study of ovarian cancer patients treated in our institution. Our results are consistent with data already described (1,2,3). Further subgroup analysis of our dataset is anticipated to determine clinicopathological characteristics and survival rates among different populations.
New insights into ovarian cancer pathology
J. Prat
Ovarian cancer
Ursula A Matulonis, Anil K Sood, Lesley Fallowfield, Brooke E Howitt, JalidSehouli, Beth Y Karlan
Epidemiology of epithelialovarian cancer
Penelope M. Webb MA, DPhil, Group Leader, Gynaecological Cancers Groupab Susan J. Jordan MBBS, PhD, Team Head, Cancer Causes and Care Group
Table I
Clinicopathological characteristics of patients
| Median (25th–75th perc) | Missing (%) | |
|---|---|---|
| Total | 1470 | 38 (2,6%) |
| Age | 59 (18 – 94) | |
| Date of Diagnosis | 01/01/1994–30/12/2018 | |
| Stage | 1416 | 54 (3,7%) |
| I | 218 (15,4%) | |
| II | 119 (8,4%) | |
| IIIa | 39 (2,8%) | |
| IIIb | 58 (4,1%) | |
| IIIc | 774 (54,7%) | |
| IV | 208 (14,7%) | |
| Histology | 1419 | 51 (3,4%) |
| Serous | 894 (63%) | |
| Mucinous | 77 (5,4%) | |
| Clear cell | 114 (8%) | |
| Endometrioid | 163 (11,5%) | |
| Poorly differentiated | 55 (3,6%) | |
| Other | 116 (8,2%) | |
| Grade | 1224 | 246 (16,7%) |
| Low (G1) | 99 (8%) | |
| High | ||
| BRCA 1/2 mutations | 92 (6,3%) | |
| Present | 27 (29,3%) | |
| Absent | 65 (70,7%) | |
| Not tested | 1378 (93,7%) | |
| Surgery | 1463 | 7 (0,4%) |
| PDS | 1254 (85,7%) | |
| IDS | 124 (8,5%) | |
| None | 84 (5,7%) | |
| ECOG | 1340 | 130 (8,8%) |
| 0 | 891 (66,5%) | |
| I | 253 (17,2%) | |
| II | 123 (9,2%) | |
| III | 61 (4,6%) | |
| IV | 11 (0,8%) | |
| 989 | 481 (32,7%) | |
| Median PFS (months) | 37,9 | |
| Median PFS - IIIC | 27,5 | |
| Median PFS - IV | 24,63 | |
| Median PFS - IIIC/IV | 26,89 | |
| 1447 | 23 (1,6%) | |
| Median OS (months) | 52,04 | |
| Median OS - IIIC | 45,16 | |
| Median OS - IV | 31,98 | |
| Median OS – IIIC/IV | 42,36 |
EXPRESSION AND LOCALIZATION OF EGFP-TAGGEG DJ-1 IN VARIOUS CANCER CELL
Kantzioura A.1, Koukiali A.2, Choli-Papadopoulou T.2, Nikolakaki E.2
1 Theagenio Cancer Hospital Thessaloniki Greece, Hellenic Society of Medical Oncology
2 Laboratory of Biochemistry, Department of Chemistry, Aristotle University, Thessaloniki
Introduction: DJ-1 is involved in various cellular processes, including transcriptional regulation, oxidative stress response, fertilization, mitochondrial regulation, and cellular metabolism. An increasing number of studies have found that the amount of DJ-1 is overexpressed in most known human cancers, which is consistent with its role as an oncogene. Interestingly, DJ-1 could be secreted by cancer cells and thus could serve as a biomarker for cancer monitoring. In this particular experiment, we try to investigate the mechanism of DJ-1 secretion in cancer cells and its invasive potential to different tumor cell lines.
Aim: The aim of the present study was the cloning of the DJ-1 cDNA in the plasmid vector pEGFP-N1, in order to study the expression of the GFP-tagged protein in HeLa, U87 and MCF-7 cancer celllines.
Methods: As a first step to monitor the expression and localization of DJ-1 both in the various subcellular compartments but also extracellularly, we used Green Fluorescent Protein as a DJ-1 tag and performed immunofluorescence experiments. To isolate DJ-1 cDNA, RT-PCR was performed on RNA isolated from K562 cells that express high levels of DJ-1. The first step consisted of reverse transcription using the M-MLV reverse transcription kit of Invitrogen, following manufacturer's instructions. Following cDNA synthesis, DJ-1cDNA was amplified by PCR with the upstream primer 5′ ATGGCTTCCAAAAGAGCTCTGGTCATCCT 3′ and downstream primer 5′ CTAGTCTTTAAGAACAAGTGGAGCCTTCACTTGAG 3′. The amplified cDNA was purified by agarose gel electrophoresis using the Nucleospin® Gel Extraction and PCR Clean-up kit of Macherey-Nagelaccording to the manufacturer's instructions. DJ-1 cDNA was again amplified by PCR from the initial cDNA with the upstream primer 5′ CGGAATTCTGATGGCTTCCAAAAGAGCTCTG 3′ and downstream primer 5′GTGGATCCCGGTCTTTAAGAACAAGTGGAGCC 3′ that contain EcoRI and BamHI restriction sites, respectively and ligated into the EcoRI/BamHI site of pGEM®-T Easy. DJ-1 cDNA was isolated from recombinant pGEM®-T Easy following digestion with EcoRI and BamHI, purified by agarose gel electrophoresis and ligated into the EcoRI/BamHI site of pEGFP-N1 for fusing Enhanced Green Fluorescent Protein (EGFP) to the C-terminus of DJ-1 protein.
An immunofluorescent approach was then employed to determine DJ-1 which was tagged at its C terminus with EGFP. To this end HeLa, MCF-7 and U87 cells cultured in DMEM medium supplemented with 10% (v/v) fetal bovine serum (FBS) and antibiotics were transfected with the chimeric cDNA using the Xfect™ transfection kit of Clontech, according to the manufacturer's instructions. Cells were grown on glass cover slips for 24–72 h. After the incubation period the cell covers lips we refixed with 4% paraformal dehydeinphosphate-bufferedsaline (PBS) for 20 min at room temperature, followed by 3 washes with 100 mMTris-HClpH 7.5 in PBS to remove excess formaldehyde and stop the fixing. DNA was stained with propidium iodide (PI)following incubation with RNAse to remove residual RNA. After 3x washing with PBS, the coverslips were mounted in 90% glycerol and visualized in a Nikon confocal microscope using the EZ-C1 3.20 software.
Results: DJ-1-EGFP was found to localize both intracellularly and extracellularly in the three cell lines tested (Figures 1, 2 and 3). The extracellular localization was more prominent in HeLa cells (Figure 1). As shown in Figures 1, 2, 3 the DJ-1-GFP protein localized mainly at the periphery of cells. A small percentage was found in the cytoplasm, while the largest fraction in the extracellular space between the adjacent cells.

Figure 1
Localization of transfected DJ-1-GFP in HeLa cells. Nuclei were stained with PI.

Figure 2
Localization of transfected DJ-1-GFP in U87 cells. Nuclei were stained with PI.

Figure 3
Localization of transfected DJ-1-GFP in MCF-7 cells. Nuclei were stained with PI.

Figure 4
Western blotting analysis, using an anti-E-Cadherin monoclonal antibody, of extracts from MCF-7 cells that were incubated for the indicated time periods with the culture supernatants of GFP- or GFP-DJ1-overexpressed HeLa cells.

Figure 5
Western blotting analysis, using an anti-B-Catenin monoclonal antibody, of extracts from MCF-7 cells that were incubated for the indicated time periods with the culture supernatants of GFP- or GFP-DJ1-overexpressed HeLa cells.
Conclusions: We noticed differentlocation and also partial extracellular secretion that depends on the cell type. These data suggest that DJ-1 overexpression and secretion area frequent event in cancer cells and emphasize its potential prognostic value as a survival marker in patients with different tumor types. Thus, DJ-1 might be a promising serum marker for cancer diagnosis, monitoring, and prognosis.
RECURRENCE IN PATIENTS WITH STAGE II COLON AND RECTAL CANCER RECEIVING ADJUVANT CHEMOTHERAPY WITH CAPECITABINE. DATA FROM LONG-TERM FOLLOW-UP OF 170 PATIENTS
Tzoudas F.1, Goura S.1,2, Spathas N.1, Lampropoulou D.3, Tzouda V.1, ElissaiouP.1, Mauri D.2, Aravantinos G.3, Stamoulis G.1, Theodoropoulos H.1, Samandas E.1, Sgouros I.1
1 C Pathology-Oncology Clinic, GONK “Agioi Anargyroi”, Athens
2 Oncology Clinic, University General Hospital of Ioannina, Ioannina
3 B Pathology-Oncology Clinic, GONK “Agioi Anargyroi”, Athens
Introduction: 25% colorectal cancer cases are diagnosed with stage II disease. The treatment of choice in these patients is resection of the tumor and depending on predetermined risk factors for recurrence either administration of adjuvant chemotherapy or simply surveillance. One of the chemotherapy options is Capecitabine especially for patients with a minor risk factor or for patients over 70 years old with risk factors.
Methods: The study was based on patients from the 3rd Oncology Clinics, diagnosed with stage II colon and rectal cancer during past 19 years and received adjunctive Capecitabine for 6 months with an initial dose of 1250mg/m2 x2 for 14 days every 21 days. Patients were divided into 3 groups. In the high-risk group for recurrence (group A) if they had at least 1 major risk factor for recurrence (T4 volume or number of lymph nodes examined <12) or at least two minor risk factors (perineurial, vascular or lymphovascular infiltration, obstruction or grade III), in the group intermediate risk (group B) if they had 1 minor risk factor and in the low risk group (group C) without any risk factor. The rate of recurrence and its time interval from the start of chemotherapy were recorded. Where statistical analysis was needed, it was done with the x2 test.
Aim: The recording of the rate of recurrence, and the time it is observed in these patients. Also the attempt to assess the value of Capecitabine in stage II colon and rectal cancer.
Results: 170 patients with a median age of 69 years (61.7% male/38.3% female) participated in the study. In groups A, B and C, 53, 18 and 66 patients were placed respectively, while in 31 patients the data were incomplete for grouping. After a median follow-up time of 47 months, 15 (9%) patients relapsed. Five (33%) of them within 6 months of the end of chemotherapy, and 3(20%) patients after 5 years (from the 5th to the 7th year after starting Capecitabine). 7.5% of group A, 5.5% of group B, and 13.6% of group C patients relapsed. There were no statistically significant differences in these percentages.
Conclusions: The low relapse rates in high and intermediate risk groups for relapse probably mean that Capecitabine is active in these patients. There may be a need to continue surveillance of these patients for two additional years beyond the 5 years recommended by the International Oncology Societies.
A RETROSPECTIVE STUDY OF TOXICITY IN PATIENTS WITH CERVICAL CANCER TREATED WITH COMPUTED TOMOGRAPHY IMAGE-GUIDED HDR INTRAVAGINAL BRACHYTERAPY
Mosa E1, Pappas N.1, Karelaki C.1, Koukourakis G.1, Karagianni P.1, Betsou S.2, Gialousis G.2, Koukorava C.2, Miliadou A.1
1Radiation Oncology Department, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
2Depatrment of Medical Physics, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
Introduction: High dose rate (HDR) brachytherapy is an essential and indisputable treatment in cervical cancer.
Aim: The demonstration of the experience of the Radiotherapy Oncology Department of General Anticancer Oncology Hospital of Athens « AGIOS SAVVAS», regarding the patients’ toxicity who underwent HDR intravaginal brachytherapy.
Methods: From January 2010 to December 2021, 135 women with cervical cancer that had undergone HDR intravaginal brachytherapy, were studied retrospectively. Fifty-two patients with stage IB-IIA, according to FIGO Staging, underwent postoperative radiotherapy, while eighty-three stage IIB-IVA patients with locally advanced disease, received a combination of chemotherapy and radiotherapy. All patients had received external radiotherapy treatment before undergoing brachytherapy. The patients were on a gynecological bed and after the insertion of an urinary catheter and the brachytherapy treatment equipment (cylinder or a combination of tandem and ovoids), underwent a computed tomography for treatment planning. In brachytherapy treatment planning, the physician delineated the target volume and the organs at risk (bladder, rectum and sigmoid) in order to be protected. The dose schemes were : 7Gyx4 and 7Gyx3, delivered once weekly. We studied acute and late side effects, from the gastrointestinal and urogenital system. The acute side effects were defined as those up to three months after brachytherapy, while the late side effects were defined as those after the trimester from the end of the therapy.
Results: Median age was 47 years old. According to RTOG grading of acute side effects, 28% of patients developed Grade I-II postradiotherapy enteritis, 7% developed Grade II cystitis and 5% developed Grade II vaginitis. As far as late side effects were concerned, 6% reported with Grade I-II colitis and, 1% with fistula (rectum vaginal, cystic vaginal)
Conclusions: Our study demonstrates that computed tomography Image-guided HDR brachytherapy, when delivered with the fractionation mentioned above, is safe and effective for cervical cancer treatment, with good local control and minimal toxicity of normal tissues.
TREATMENT OF VAGINAL INTRAEPITHELIAL NEOPLASIA (VAIN)
Karagianni P1, PappasN.1, Strataki K2, Tzamourani Ch2., Koukourakis G1, Betsou S.3, Papatheodorou D.2, Miliadou A.1
1 Department of Radiation Oncology, «Saint Sawas» Hospital
2 Department of Gynaecological Oncology, «Saint Savvas» Hospital
3 Department of Medical Physics, «Saint Savvas» Hospital
Aim: In our department from October 2020 to December 2021 we treated 6 patients suffering from vaginal intraepithelial neoplasia. These are patients who have had a prior hysterectomy. Their average age was 63 years old.
Methods: The patients underwent IC Brachytherapy (HDR) with a vaginal cylinder and a 3D technique in 6 fractions, 1 per week. Each fraction administered 6.0 Gyadding to a total dose of 36.
Results: After completion of the treatment two of our patients (30%) developed intense irritation of the vagina and a skin reaction in the area of the vulva for which appropriate supportive treatment was given. One patient (17%) developed fungalvaginitis infection. Two patients developed dysuria. One patient developed cystitis. Approximately a year after the end of brachytherapy two patients developed skin necrosis in the area surrounding the vulva for which appropriate treatment was given.
Conclusions: All patients have completed their treatment and are under follow up. Currently all of them are disease free.
ASSESSMENT OF OVARIAN FUNCTION AND RECOVERY AFTER CHEMOTHERAPY IN PREMENOPAUSAL WOMEN WITH EARLY BREAST CANCER
Vrana E1, Douganiotis G2, Kontovinis L1, Markopoulou E1, Papazisis K1
1Medical Oncology Department, Euromedica General Clinic, Thessaloniki, Greece
23rd Department of Medical Oncology, Theagenio Cancer Hospital, Thessaloniki, Greece
Introduction: One of the unpleasant side effects of chemotherapy is the suppression of ovarian function in premenopausal women. This phenomenon is usually assessed subjectively via the interruption and recovery of menses. An objective method of assessment of ovarian function is hormonal testing.
Methods: Data from the medical records of Oncomedicare were retrospectively collected. The analysis included patients who were diagnosed with early breast cancer, were premenopausal at diagnosis, and received chemotherapy. The patients were stratified in two age groups: 22–40 years of age and 41–50 years of age. The levels of Follicular Stimulating Hormone (FSH), Luteinizing Hormone (LH) and Estradiol (E2) were recorded in patient follow-up appointments after the end of chemotherapy, and their correlation with the recovery of menses was assessed.
Results: A total of 408 premenopausal women who received chemotherapy were included. 182 were between 22–40 years of age, and 226 were between 41–50 years of age. 295 patients were Hormonal Receptor (HR)-positive and 113 were HR-negative. Assessment of ovarian function recovery was performed in 308 patients (patients were excluded if they a) were still receiving an LHRH analogue, b) had performed an ovariectomy, or c) had very early disease recurrence). The FSH and LH values were on average lower and the E2 values were on average higher in the age group 22–40 years versus the age group of 41–50 years. The probability of menses recovery was statistically significantly higher in values for FSH<20 compared to FSH>20 (p<0.0001), LH<20 compared to LH>20 (p=0.0204), and E2>20 compared to <20 (p<0.0001).
Conclusions: The levels of FSH, LH and E2 are directly related to the recovery of menses in women after chemotherapy, and their measurement constitutes the most reliable method of assessment of ovarian function.




ASSESSMENT OF THE CONCORDANCE IN HER2 EXPRESSION BETWEEN THE PRE-TREATMENT BIOPSY AND THE SURGICAL SPECIMEN IN WOMEN WITH EARLY BREAST CANCER
Douganiotis G1,2, Kontovinis L2, Zarampoukas Th3, Natsiopoulos I4, Papazisis K2,4
13rd Department of Medical Oncology, Theagenio Cancer Hospital, Thessaloniki, Greece
2Medical Oncology Department, Euromedica General Clinic, Thessaloniki, Greece
3Istodiereunitiki SA
4Breast Cancer Center, Interbalkan European Medical Center, Thessaloniki, Greece
Introduction: The diagnosis of early breast cancer is established via biopsy, and the immunohistochemical assessment of the biopsy specimen is crucial for determining the treatment plan. Immunohistochemistry (IHC) is not always repeated on the surgical specimen. However, it is possible for immunohistochemistry results to be different between the biopsy and the surgical specimen, a fact with treatment repercussions, especially regarding the expression of HER2.
Methods: Data from the medical records of Oncomedicare were retrospectively collected from 2011 to 2021. The analysis included all patients with early breast cancer who were operated, for whom data were available regarding the expression of HER2 on both the pre-treatment biopsy and the surgical specimen. Additional stratification was performed according to the administration of neoadjuvant therapy. Exact HER2 expression was recorded in both specimens (IHC 0, +1, +2 ISH-negative, +2 ISH-positive, +3), and the concordance percentage between the two was calculated.
Results: A total of 177 patients who received neoadjuvant treatment and 339 patients who received surgery without any prior treatment were included in the analysis. In the group who received neoadjuvant treatment, the concordance percentage was 72.5% for HER2 (0), 73.6% for HER2 (+1), 34.6% for HER2 (+2, ISH-neg), 50% for HER2 (+2, ISH-pos) and 81.5% for HER2 (+3). 7 out of 138 patients who had been designated as HER2-negative based on the biopsy were found to be HER2-positive on the surgical specimen (5.1%). 10 out of 40 patients who had been designated as HER2 (0) on the biopsy were found to be HER2-low on the surgical specimen (25.0%). In the group who received surgery without any prior treatment, the concordance percentage was 71.1% for HER2 (0), 66.9% for HER2 (+1), 50% for HER2 (+2, ISH-neg), 100% for HER2 (+2, ISH-pos) and 60% for HER2 (+3). 7 out of 301 patients who had been designated as HER2-negative based on the biopsy were found to be HER2-positive on the surgical specimen (2.3%). 40 out of 142 patients who had been designated as HER2 (0) based on the biopsy were found to be HER2-low on the surgical specimen (28.2%).
Conclusions: HER2 expression may differ between the biopsy and the surgical specimen and should be assessed in both specimens. after neoadjuvant treatment
| HER2-ResD | ||||||
|---|---|---|---|---|---|---|
| HER2-0 | HER2-1 | HER2-2neg | HER2-2pos | HER2+3 | ||
| HER2-core | HER2-0 | 72.5% | 22.5% | 2.5% | 0.0% | 2.5% |
| HER2-1 | 11.1% | 73.6% | 9.7% | 0.0% | 5.6% | |
| HER2-2neg | 15.4% | 42.3% | 34.6% | 3.8% | 3.8% | |
| HER2-2pos | 0.0% | 33.3% | 8.3% | 50.0% | 8.3% | |
| HER2+3 | 7.4% | 3.7% | 3.7% | 3.7% | 81.5% |
would the treatment plan change?
without neoadjuvant treatment
| HER2-Surgery | ||||||
|---|---|---|---|---|---|---|
| HER2-0 | HER2-1 | HER2-2neg | HER2-2pos | HER2+3 | ||
| HER2-core | HER2-0 | 71.1% | 26.8% | 1.4% | 0.7% | 0.0% |
| HER2-1 | 12.9% | 66.9% | 17.3% | 1.4% | 1.4% | |
| HER2-2neg | 10.0% | 35.0% | 50.0% | 5.0% | 0.0% | |
| HER2-2pos | 0.0% | 0.0% | 0.0% | 100.0% | 0.0% | |
| HER2+2-ND | 10.0% | 20.0% | 65.0% | 5.0% | 0.0% | |
| HER2+3 | 0.0% | 13.3% | 6.7% | 20.0% | 60.0% |
Would the treatment plan change?
PALLIATIVE RADIOTHERAPY FOR THE TREATMENT OF OBSTRUCTIVE ATELECTASIA IN PATIENTS WITH ADVANCED LUNG CANCER
Soulimioti G., Fotopoulou A., Ploxorou M., Tzorakakis S., Girlemis K., Maravelis I., Athanassiou E.
Radiotherapy Department of General Oncologic Hospital “Agioi Anargiroi”
Aim: The primary end point of our study is to evaluate the use of palliative radiotherapy for the treatment of obstructive atelectasiain patients with lung cancer.
Methods: From 01/2010 to 12/2020, 111 patients with complete obstruction of the main airway from lung cancer had received palliative radiotherapy. 67% had NSLCC and 33% SLCC.76 patients was males (68%) and 35 females (32%). The median age was 69 years (range 36–85 years).70% of the patients had N3 cancer. All the patients had dispnea and cough. The lung –CT show post-obstructive atelectasia. All the patients received 3-D CONFORMAL RADIOTHERAP in diverse shema.:20Gy/5 fractions in 19 pt (17%), 10Gy/2 fractions in 31 pt (28%) and 7Gy/1 fraction in 61 pt (55%). The treatment planning was the lung-tumor and the mediastinal lymphnodes (Gross –Tumor-Volume GTV)
Results: The clinical symptoms of obstruction (dyspnea and cough) were improved in 78 patients (70.3%) one week after the end of radiotherapy. The lung-CT after two weeks show imaging improvement. The acute toxicity ranges in low grades (esophagitis grade II-III only in 7% of patients).
Conclusions: Palliative radiotherapy is an efficacy and safe treatment for the treatment of obstructive atelectasia in patients with lung cancer. The improvement of severe symptoms, improve the quality of their life.
SEXUAL FUNCTION AND QUALITY OF LIFE (QOL) IN PATIENTS WITH GYNAECOLOGICAL CANCER AFTER BRACHYTHERAPY: A PROSPECTIVE STUDY
Mosa E.1, Miliadou A.1, Karagianni P.1, Pappas N.1, Koukourakis G.1, Vassilakou E.1, Betsou S.2, Koukorava C.2, Gialousis G.2, Fasoulaki A.3, Kachris S.3, Seretis A.1, Gerogiannis S.1, Poulinaki E.1, Karelaki C.1, Zampatis C.1, Tolia M.3
1Radiation Oncology Department, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
2Depatrment of Medical Physics, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
3Radiation Oncology Department, University Hospital of Heraklion/Medical School, University of Crete
Introduction: Maintaining the normal sexual activity in women who have undergone HDR brachytherapy to treat gynaecological cancer, is essential for their quality of life (QoL).
Aim: To evaluate the sexual function and quality of life pre- and post-gynaecological cancer treatment with HDR brachytherapy.
Methods: This is a prospective study involving 54 women diagnosed with gynaecological cancer. We used the Quality of Life Questionnaire Core 30(QLQ-C30) 3.0 to assess Quality of Life pre- and post-HDR brachytherapy treatment. We also used the SHO-22 Questionnaire to assess sexual function.
Results: The median age was 65 years old. Thirty-five women suffered from endometrial cancer, while seventeen were diagnosed with cervical cancer and two with vaginal cancer. Regarding quality of life, 9% of the patients were found with post radiation colitis Grade I-II, while the women that had referred constipation pre-brachytherapy treatment, declared improvement. It was reported vaginal dryness in 11.5% of the patients. Regarding sexual function, 40.8% was active at the time of diagnosis, 11% abstained from sex because of fear, 9% reported decreased sexual desire and 7% stated dyspareunia.
Conclusions: Quality of life and late postradiotherapy toxicity in women with gynaecological cancer, should be monitored regularly, after HDR brachytherapy treatment. In this way, the patients that need further support or care, could be detected on time. Holistic monitoring of gynecological cancer patients should include interdisciplinary collaboration, with the aim of achieving optimal quality of life.
REAL-WORLD DATA ON SYSTEMIC THERAPY IN PATIENTS WITH HEPATOCELLULAR CARCINOMA
Geka D., Kokkali S., Kranidioti H., Mani I., Alexopoulou A., Deutsch M.M., Manolakopoulos S., Koskinas I.
2nd Academic Department of Internal Medicine, Hippocration General Hospital, National and Kapodistrian University of Athens, Athens, Greece
Introduction: Hepatocellular carcinoma (HCC) occurs most often in patients with cirrhosis and chronic liver diseases. Its prevalence and mortality have increased over the last years. Until recently, sorafenib was practically the only available systemic therapy for unresectable HCC, while a variety of other agents have been added in the armamentarium against this disease during the last 5 years, both in the first and 2nd-line setting.
Aim: This study was conducted to collect real-world data on the use of systemic therapies in patients with HCC, as well as their safety and efficacy.
Methods: We retrospectively analyzed all medical records of HCC patients, who were treated in the Oncology Unit of the 2nd Academic Department of Internal Medicine Hippocration General Hospital between January 2020 and January 2022. We collected epidemiological and clinical characteristics of patients, data on treatment outcomes and adverse events. For survival analysis the Kaplan Meier method was used.
Results: In total, 17 patients (3 female and 14 male) received systemic therapy for Barcelona Clinical Liver Cancer stage C HCC during the study period. Median age was 65 years (45–89). In the majority of patients HCC was associated with cirrhosis related to viral hepatitis, followed by cirrhosis of mixed aetiology (alcoholic and viral), while a small percentage of patients had metabolic hepatic disease. Only 4 patients developed extrahepatic metastases (lymph nodes and bones). Approximately half of the patients had undergone local therapy before systemic treatment. Patients received a median number of 2 (1–5) lines of systemic therapy. Median overall survival from the initiation of systemic treatment was 13 months. Toxicity was as expected from the registration studies of the different drugs. We did not observe any toxic death.
Conclusions: Sequential systemic treatments prolong survival of patients with advanced HCC. Despite the potential adverse events, the different drugs can be administered in this sensitive group of patients.
THE EXPERIENCE OF RADIATION ONCOLOGY DEPARTMENT OF GENERAL ANTICANCER HOSPITAL «AGIOS SAVVAS» IN THE ADMINISTRATION OF EXTERNAL RADIOTHERAPY IN OCULAR LYMPHOMA
Mosa E.1, Karagianni P.1, Poulinaki E.1, Pappas N.1, Karelaki C.1, Koukourakis G.1, Vassilakou E.1, Koligliatis A.2, Andreou M.2, Betsou S.2, Gialousis G.2, Koukorava C.2, Zampatis C.1, Miliadou A.1
1Radiation Oncology Department, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
2Depatrment of Medical Physics, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
Introduction: Ocular lymphomas stand for 1–2% of non-Hodgkin's lymphomas (B-NHL). Depending on the stage of the disease, treatment includes external radiotherapy as monotherapy or in combination with chemotherapy or immunotherapy.
Aim: A retrospective study of patients with ocular lymphoma that have received external radiotherapy in our department, the recording of acute and late postradiotherapy toxicities, disease free survival and overall survival.
Methods: From August 2015 to December 2021, 16 patients with ocular lymphoma underwent external radiotherapy. The patient was in a supine position, with a special wire in the outer corners of the orbits and an individualised thermoplastic mask. The planning target volume (PTV) was delineated and the organs at risk as the spinal cord, brainstem, ipsilateral and contralateral eye and lens. A special layer was used to protect the lens as long as they were not adjacent to the disease. The age and sex of the patients, the type and stage of the disease, the kind of treatment and the outcome were recorded.
Results: Median age was 62 years old. Nine patients were women and 7 were men. Stage I-II was 88%, while the remaining 12% was III-IV. Fifteen patients suffered from B-NHL ocular MALT type and only 1 from diffuse large B-cell NHL. Orbital lymphoma was presented in 75% and conjunctival lymphoma in 25%. Patients with stage I-II were treated with 30Gy/2Gy, while those with locally advanced or systemic ocular disease were treated with a combination of chemo-radiotherapy, with a total radiobiologically equivalent dose of 36-40Gy. Only 2 patients developed grade II-IV acute dermatitis, while 14 developed mild dryness of the eye, conjunctivitis and grade I-II dermatitis. Fifty-six percent of the cases reported with complete response while 18.7% showed progression disease and 12.5% of the patients died.
Conclusions: Radiotherapy for patients with ocular lymphoma is an effective treatment with good tolerance.
A RARE AND ATYPICAL BEHAVIOR OF BASALOID SQUAMOUS CELL CARCINOMA OF THE MOUTH-FLOOR
Drositis I., Kontopodis E., Symseridis N., Bachlitzanaki M., Androulakis N.
Department of Oncology, “Venizeleio-P.G.N.H” General Hospital, Heraklion Crete, Greece
Introduction/Aim: Basaloid squamous cell carcinoma (BSCC), had been initially regarded as an aggressive and rare, high-grade variant, of conventional-squamous-cell-carcinoma (SCC). This hypothesis is still a matter of debate in literature. With this manuscript we try to help clarify the clinical behavior and prognosis of BSCC, and to report an extremely rare distant-metastasis.
Methods: We present a case of a 64-year-old female, who appeared, with clinical features of a typical primary gynecological-cancer. Physical examination revealed invasion of the Uterine-Cervix and Vagina. Immunohistochemistry, taken from vagina, cervix, and liver, identified metastasis from a Basaloid-squamous-cell-carcinoma, deriving from a primary, early-stage cancer of the mouth-floor, which had been successfully, treated four-years ago.
Conclusions: Despite the favorable and the long-term course of the disease, the patient relapsed, and died five-years after diagnosis, due-to distant and unusual metastases. That makes us argue in favor of the supposed higher clinical-aggressiveness, and worse-prognosis of BSCC compared to conventional-SCC.
Keywords: Basaloid-squamous-cell-carcinoma, oral-cancer, squamous-cell-carcinoma, vaginal-metastases, cervix-metastases
REGRESSED GERM CELL TUMOUR
Kostaridis E.1, Michas A.1, Arvanitou E.1, Gkikas K.1, Tsitsibis A.1, Tzelepis B.2, Kagkaras Ch.1, Zouraris D.1, Gkiaouraki M.1, Ballasis K.1, Christofyllakis Ch.1, Tsoukalas N.1
1 Oncology Clinic, 401 GMHA
2 Urology Clinic, 401 GMHA
Introduction: Germ Cell Neoplasia In Situ (GCNIS) is considered as an earlystage malignant germ cell tumour (GCT) with increased chances of metastases. GCTs also include a rare histological type known as regressed GCT, an early GCT that suddenly regresses and usually presents with metastases.
Aim: This work aims to present a patient with regressed GCT in the absence of metastases.
Methods: Patient presentation: A 30-year-old patient presented for a focal nodular left testicular lesion with a maximum diameter of 1.55 cm in imaging tests (u/s, triplex, MRI) without symptoms. He also provided laboratory tests that were performed regularly and showed elevated FSH, LH and PRL values, while the biomarkers (AFP, B-hCG, LDH) were within normal limits.
Results: After confirming the presence of a mass, a radical left orchiectomy was planned. The histological examination revealed GCNIS lesions that probably concern completely regressed GCT. The epididymis, seminiferous tubules and spermatic cord were free of essential changes. CT scans of the chest and upper-lower abdomen were performed in which there were no findings of diffuse disease. Based on the current literature, it was decided that the patient should not receive any adjuvant treatment but should be put on a follow-up program.
Conclusions: Regressed GCT is a rare histological type that usually presents with metastases. Patients with this histological type should undergo a complete imaging test to exclude the presence of metastases. In the absence of metastases, a follow-up program without adjuvant treatment is recommended.
ACUTE TOXICITY AND BIOCHEMICAL RESPONSE IN 201 PATIENTS WITH LOCALIZED PROSTATE CANCER TREATED WITH HYPOFRACTIONATED RADIOTHERAPY (HRT) BASED ON THE CHHIP-TRIAL PROTOCOL. THE BANK OF CYPRUS ONCOLOGY CENTRE EXPERIENCE
Georgiou M., Kasapi D., Moumtzidou M.A., Vomvas D., Andreopoulos D.
Radiation-Oncology Clinic, Bank of Cyprus Oncology Centre (BOCOC)
Introduction: In recent years, HRT is one of the treatment options for patients with localized prostate cancer. It is a treatment regimen recommended by all international guidelines. Many randomized clinical trials have shown similar efficacy and toxicity compared to conventional fractionation regimens.
Aim: Evaluation of acute toxicity and biochemical response in patients with localized prostate cancer who received HRT.
Methods: We performed a retrospective evaluation of the medical records of the 201 patients irradiated with a total dose of 60Gy in 20 fractions, over the last 5 years with IGRT, VMAT technique. Of the total number of patients enrolled in the study, the distribution in the risk groups according to the EAU was low risk of 30.5%, intermediate risk of 43.5% and high risk of 26%.
Results: Most patients tolerated the treatment well. One patient discontinued treatment for personal reasons. Regarding the acute toxicity (RTOG) from the genitourinary system, we observed that ≥Grade 2 toxicity amongst 41.5% of patients. The rate of acute toxicity (RTOG) from the gastrointestinal system was 12.5%. Essentially, we observed excellent biochemical response in most patients at 12 weeks after the completion of the treatment. More than 50% decrease in PSA from that of baseline measurement was achieved in approximately 98.8% of patients.
Conclusions: Our results confirm that HRT in patients with localized prostate cancer is a well-tolerated treatment with biochemical response rates particularly high. Due to the relatively short period of treatment, patient's compliance is much higher compared to the conventional RT regimens.
THE ADVANTAGE OF A MULTI-GENE ANALYSIS APPROACH IN NSCLC PATIENTS
Tsantikidi K.1, Metaksa – Mariatou V.1, Florou-Chatzigiannidou C.1, Meidani A.1, Maravelaki S.1, Kapetsis G.1, Tsaousis G.1, Bourkoula E.1, Fotiou D.1, Mihala A.1, Potska K.1, Letsa I.2, Zervas E.3, Samitas K.3, Euthimiadis K.4, Floros T.5, Mountzios I.6, Kosmidis P.7, Karanikiotis C.8, Tsiouda T.9, Botsolis K.10, Kabletsas E.11, Adamidis A.12, Papadopoulou I.1, Nasioulas G.1
1GENEKOR Medical S.A, Athens
2Athens Medical Center Oncology Clinic, Athens
3“Sotiria” hospital, Athens
4Metropolitan Oncology Clinic, Athens
5Errikos Ntynan D' Oncology Clinic, Athens
6Bioclinic Oncology Clinic, Thessaloniki
7Athens Diagnostic & Therapy Center, Ygeia, Athens
8424 Military Hospital, Thessaloniki
9Theageneio Cancer Hospital, Thessaloniki
10Interbalkan Medical Center, Thessaloniki
11University General Hospital, Ioannina
12Saint Lucas Hospital, Thessaloniki
Introduction: The most common cancer-related cause of death is lung cancer, with a relatively poor prognosis, since 75% of patients are diagnosed at an advanced stage. In the last decade, new data concerning the management of NSCLC have come to light, with significant progress made in its screening, diagnosis and treatment. The revolutionary progress in treatment is mainly due to the development of molecularly targeted therapeutic approaches. The development of next generation sequencing (NGS) technology plays an important role in individualized medicine. Since the first clinical trials targeting the epidermal growth factor receptor (EGFR) in 2001, a number of targeted anti-cancer drugs, such as EGFR, ALK, ROS1, RET, BRAF, NTRK, MET and KRAS inhibitors, are now available for NSCLC patients carrying pathogenic mutations in those genes. In fact, in 2021, new inhibitors targeting the mutant KRAS-G12C protein (present in 13% of NSCLC patients) were approved, indicating that targeted therapy could be extended beyond current oncogenic targets.
Methods: 1059 tissue biopsies analysis from patients with NSCLC was processed. The analysis was based on a targeted panel of 24 genes and 6 rearrangements and the sequencing was performed on the NGS platform Ion Gene Studio S5 Prime System (Thermo Fisher Scientific).
Results: Mutations were detected in 77% of the samples, of which 30.4% concerned patients who could benefit from the administration of approved targeted therapy. The KRAS p.G12C mutation and EGFR mutations were detected in 12.7% and 12.2% of the samples, respectively, followed by mutations in other molecularly targeted genes, such as BRAF p.V600E (1.8%), MET ex.14 skipping (1%), and ALK / ROS / RET rearrangements (2.2%). PD-L1 expression analysis was also performed in 532 patients, of which 37% had a positive result. Worth mentioning is the fact that 25% of the PD-L1+ samples were negative for mutations in approved targeted therapeutic biomarkers. Therefore, the total percentage of patients who could benefit from approved targeted therapy or immunotherapy reaches an outstanding 55%.
Conclusions: Considering the fact that the analysis of a single gene, in particular EGFR analysis, results in a small number of patients who would benefit from targeted therapy (12%), the represented data support a multi-gene analysis approach. This percentage will be increased even more, with the addition of PD-L1 analysis of the NSCLC patients.
RETROSPECTIVE STUDY OF THE GENETIC PROFILE OF SARCOMAS IN GREECE: A COOPERATIVE PROGRAM BETWEEN THE HELLENIC GROUP OF SARCOMAS AND RARE TUMORS (EOSSO) AND NATIONAL NETWORK OF MEDICAL PRECISION IN ONCOLOGY (EDIAO)
Kyriazoglou A.1, Kokkali S.2, Koulouridi A.3, Mala A.3, Tsoukalas N.4, Tripodaki E.5, Assi A.1, Karabeazis A.4, Kotsantis I.1, Koutsoukos K.6, Zakopoulou R.1, Zarkavellis G.7, Hatzara E.8, Koinis F.8, Kotsakis A.8, Georgoulias V.9, Laidou S.10, Chatzidimitriou A.10, Boukovinas I.11
1 2nd Propaedeuctic Dept. Attikon University hospital
2 2nd Dept of Internal Medicine, Ippokrateion General Hospital
3 Oncology Dept University hospiytal of Herakleion
4 Oncology Dept NIMTS hospital of army veterans
5 1st Dept of Medical oncology, Aghios Savvas anticancer hospital
6 Dept of Clinical therapeutics Alexandra General hospital
7 Oncology Dept Ioannina University hospital
8 Oncology Dept University hospital of Larissa
9 1st Oncology Dept Metropolitan hospital
10 EDIAO
11 Bioclinics Thessaloniki
Introduction: Sarcomas are rare tumors of mesenchymal origin with high heterogeneity. The basic treatment for local disease is surgical resection. In metastatic disease the available systemic treatments are limited. Detection of targeted genetic abnormalities in sarcomas is still of dubious clinical significance.
Methods: The clinical and laboratory data of patients with sarcoma, who had been included in an NGS test in the context of the operation of EDIAO, were collected retrospectively by EOSSO, at the relevant request of the treating physician. Fixed material (from primary tumor or metastasis) was used for DNA sequencing analysis in a panel of 58 genes. Statistical analysis was performed using SPSS software.
Aim: The study in the Greek population of the results of next generation sequencing in patients with sarcomas through the National Network of Precision Medicine in Oncology (EDIAO) in collaboration with the Greek group of sarcomas and rare tumors (EOSSO).
Results: A total of 49 sarcoma cases were analyzed. The most common types were leiomyosarcoma (9.18%), liposarcoma (9.18%), malignant fibrous tumor (3.6%) and malignant peripheral nerve sheath tumor (3.6%). 55 genetic abnormalities and 9 target mutations were identified. Five (5) patients received treatment based on the detection of targeted abnormalities. Three patients received treatment with olaparib without clinical benefit. One patient was treated with the dabrafenib / trametinib combination and has been receiving this treatment for over 12 months. One patient receives crizotinib for 5 months and continues on treatment.
Conclusions: Our study confirms the existence of clinically targeted abnormalities in patients with sarcoma. However, their frequency is low and the clinical benefit depends on the type of mutation.
| Sarcoma type | site of primary | sex | age | stage | site of NGS | mutation | line of targeted treatment | drug | duration |
|---|---|---|---|---|---|---|---|---|---|
| ES | Big toe foot | Male | 39 | metastatic | metastasis | RAD50, BRCA2 | 4th | Olaparib | 2,5 months |
| uLPS | ampulla of Vater | Female | 77 | metastatic | metastasis | CHEK2 | 2nd | Olaparib | 1 month |
| MPNST | unknown primary tumor | Male | 48 | metastatic | metastasis | BRAF | 1st | Dabrafenib/Trametinib | 12 months |
| IFT | abdomen | Female | 68 | local | Primary tumor | ALK | 1st | crizotinib | 6 months ongoing |
| ERMS | jaw | Male | 22 | lung | metastasis | BRCA1 | 7th | olaparib | 1 month |
TREATMENT OF LOCALLY FAR ADVANCED SQUAMOUS CELL CARCONIMA OF THE SKIN (LA-SQCSC) WITH ANTI-PD-1 IMMUNOTHERAPY (CEMIPLIMAB)
Mamalis P., Giaktzidis A., Koukourakis I., Xanthopoulou E., Koukourakis M.
Department of Radiation Oncology, University Hospital of Alexandroupolis, Medical school of Democritus University Of Thrace, Greece
Introduction: The expression of inhibitory control molecules immune response on the surface of cancerous cells, allow cancer cells to escape by immune surveillance. PD-L1 (programmed deathlig and 1) binds to their PD-1 receptor of cytotoxic T cells leading to inhibition of their anticancer activity. Anti-PD1 Mo Abcemiplimab blocks PD-1/PD-L1 binding. The cemiplimab is approved for the treatment of advanced and metastatic squamous cell carcinoma of the skin (SqCSC; squamous cell skin cancer).
Patients Methods: We present four patients with locally far-advanced SqCSC (LA-SqCSC), through a prospective study that aims to investigate the role of cemiplimab and the timing sequence of radiotherapy/immunotherapy in treatment of this aggressive disease. The dose of cemiplimab was 350 mg, diluted in 250 ml N/S and given as a 1-hour infusion every 3 weeks.
Results: Case 1: 88-year-old man in the left cheek area LASqCSC who relapsed after chemo/Rt. Immediately after the 1st cycle of cemiplimab was observed substantial improvement and during the 10th cycle full remission was documented, which lasts 15months. Case 2: 82-year-old man with right LA-SqCSC upper frontal thoracic wall / shoulder. Treatment with cemiplimab led to a complete response during the 5th cycle which lasts 18 months. Case 3 : 81-year-old man with LA-SqCSC in the right parotid region showed progression disease during Chemo. From the 1st cycle of immunotherapy observed improvement and complete response achieved in the 7th cycle, which lasts 14 months. Case 4: 73-year-old man with ulcerated LA-SqCSC aural country. A complete response was achieved on the 4th cycle, which lasts 6 months. Skin toxicity observed in 1/4 of patients.
Conclusions: LA-SqCSC is an inoperable disease, difficult to treat with Radiotherapy, due to the large field dimensions and the extensive existing ulcerations. Anti-PD-1 immunotherapy with cemiplimab proved highly effective. The role of Radiotherapy in cases with incomplete response or relapse after immunotherapy-is under investigation.
INR DISORDER IN CONCURRENT ADMINISTRATION OF ACENOCOUMAROL ANDPOSACONAZOLE AFTER RADICAL EXTERNAL RADIOTHERAPY
Karelaki C.1, Seretis A.1, Karagianni P.1, Pappas N.1, Vasilakou E.1, Poulinaki E.1, Gerogiannis S.1, Koukourakis G.1, Betsou S.2, Miliadou A.1
1Radiation Oncology Clinic, General Anti-Cancer Oncology Hospital ‘Saint Savvas’, Athens, Greece
2Medical Physics Department, General Anti-Cancer Oncology Hospital ‘Saint Savvas’, Athens, Greece
Introduction: Patients who are undergoing head and neck radiotherapy often present with severe mucositis requiring the administration of antifungals, especially azoles. Azoles are inhibitors of CYP450 thus increasing the effect of other drugs such as coumarin anticoagulants.
Aim: Posaconazole is considered a safe drug with less adverse effects than other azoles. In this case report we would like to indicate that there is still the danger of bleeding if it is co-administered with coumarin anticoagulants.
Methods: A 67-year-old woman with non-surgical, non-chemotherapeutic right buccal mucosa melanoma underwent radical radiotherapy while receiving acenocoumarol to regulate chronic atrial fibrillation. Posaconazole solution
15cc/day for 7 days was administered due to severe mucositis in the last radiotherapy session. She was hospitalized one week later due to hematuria, right cheek mucosal bleeding and Hb anemia: 6.9 g/dl and undefined INR without platelet disorder. During her treatment, the administration of acenocoumarol was stopped and she received a total of 4 units of RBCs, 2 units of FFPs and 10mg of vitamin K once. Antifungal treatment had already been discontinued.
Results: She was hospitalized for 5 days and discharged in good condition without hematuria, mucosal bleeding with recovery of Hb: 9.1 g/dl and INR: 3.35. Symptoms were resolved on the second day of hospitalization after discontinuation of anticoagulant therapy and FFP.
Conclusions: The concomitant administration of coumarin anticoagulants and azoles should be done with extreme caution. A possible suggestion is to modify the anticoagulant treatment with other medications, such as low molecular weight heparin.
PRESENTATION OF A THERAPEUTICALLY COMPLEX CASE OF XERODERMA PIGMENTOSUM THAT RESPONDED TO IMMUNOTHERAPY
Mentesidou V.1, Dionysopoulos D.1, Apalla Z.2, Dionysiou D.2, Mpoziou M.2, Lallas K.1, Timotheadou E.1
1Medical Oncology Clinic Aristotle University of Thessaloniki, Greece
22nd Dermatology Clinic Aristotle University of Thessaloniki, Greece
Introduction: Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder of DNA repair and is caused by mutations in one of the genes involved in the recognition and repair of ultraviolet radiation (UVR) - induced DNA damage. Clinical findings involve increased sensitivity to ultraviolet radiation (UVR), development of skin cancers usually in the first decade of life and progressive neurodegeneration. The diagnosis is established based upon confirmatory genetic testing.
Aim: Presenting a patient's case of XP diagnosed at the age of 10 years old, that after surgical excision of BCC and SCC, is treated with cemiplimab.
Methods: A 29 year – old patient with XP and a medical history of multiple NMSCs and MM since the age of 10 that was treated elsewhere and with sensorineural hearing loss 77% in both ears, presented at the outpatient Dermatology Clinic with multiple face tumors and the diagnosis of 2 SCC, 9 BCC tumors and 2 MM in remission, was made. She was treated with local imiquimod 5%, photodynamic therapy and systemic acitretin. However the SCC of the right lower eyelid that spread to the conjunctiva, demanded eye extraction and so treatment with cemiplimab after an MDT meeting, was decided.
Results: The patient received local and systemic treatments and showed a very good response with cemiplimab, based on the recent disease restaging.
Conclusions: Even though treatment of skin cancers is wide local excision, in our patient's case it was impossible. Immunotherapy in combination with other treatments offers new possibilities for these patients.
THE CONTRIBUTION OF MEDICAL COUNCILS AT THE CONTEMPORARY CLINICAL PRACTICE
Pispirigou M.K.1, Mavroforou A.2, Giannoukas A.3
1Medical Oncologist, Division of Oncology, University Hospital of Patras, Greece
2Professor of Deontology and Ethics, Department of Nursing, University of Thessaly, Larisa, Greece
3Professor or Vascular Surgery, Department of Medicine, University of Thessaly, Larisa, Greece
Introduction: There have always been medical councils that took place at the clinics. The first scientist in Ancient Greece to lay the foundations of the collective medical profession in his work entitles “orders” was Hippocrates. By definition a medical council is a group of physicians who are to decide as a collective on the best treatment for the patient according to guidelines and values of deontology and bioethics.
Aim: This closed qualitative study sets out to investigate how Medical Councils contribute to the contemporary clinical practice. During the pandemic there have been many complex medical cases that need a special and immediate treatment through a fruitful coordination and critical co-decision of multiple physicians’ specialties and fields.
Methods: A closed questionnaire with twelve calibrated questions was available for this qualitative study. The selected population has been the physicians of Patras University Hospital in Rio Patras Greece across all specialties and fields.
Results: Physicians of thirteen medical specialties of both genders took part in this research, highlighting the importance and contribution of medical councils in clinical practice. A vast majority of them (74%) replied that they have taken part in a medical council but only (45%) of them knew the definition of a medical council. Most of them (91%) replied that the decisions made by a medical council were accepted by the patient in need and (93%) replied that these decisions helped patent's condition in the best possible way.
Keywords: Medical Councils, contemporary clinical practice, medical cases, critical co-decisions, treatment, patient, Hippocrates
SINGLE FRACTION PALLIATIVE RADIOTHERAPY OF 8 GY FOR PAIN CONTROL OF BONE METASTASES
Soulimioti G., Fotopoulou A., Ploxorou M., Tzorakakis S., Girlemis K., Maravelis I., Athanassiou E.
Radiotherapy Department of General Oncologic Hospital “Agioi Anargiroi”
Introduction: Bone is the most common site of distant metastasis in patients with breast, lung and prostate cancer. The pain diminishing the quality of life of cancer patients. Radiotherapy can improves the pain control and diminishing the analgesics drugs.
Aim: The primary end point of our study was the pain response after 8Gy single fraction radiotherapy.
Methods: Between 2010 and 2020, 1209 patients were treated in our department for painful bone metastases of solid tumors.672 were males and 534 were females. The median age was 56 years (range:30–89).31% of patients had breast cancer,19 % had NSCLC o SCLC lung cancer,37% had prostate tumors and 12% had renal bladder, rectal, kidney, uterus tumors. All the patients received analgesic drugs. The commonest sites of metastases was the lumbar spine (35%), pelvis (26%), thoracic spine (18%), the femurs (7%), and others bone sites. In our study there is no compession of spine cord. Patients had no received radiotherapy before. All the patients treated with 3D-conformal Radiotherapy for a total dose of 800cGy in a single fraction. The pain score was calculated by the Breif Pain Inventory Test (BPI).
Results: After one month of radiotherapy treatment 22% of the patients had complete response (complete disappearance of pain and withdrawal of analgesic drugs), 61 % had partial response (significant decrease of analgesic drugs), 19% had no response and 4% had progressive disease (increase of analgesic drugs). After three months of radiotherapy 13% of patients received a second fraction of 800cGy in the same area (re-irradiation). The acute and late toxicity was range in grade I-II (dermatitis, diarrhea, proctitis).
Conclusions: 8Gy single fraction radiotherapy for painful bone metastases is an efficacy and safe treatment for these patients and improve the quality of their life.
A RARE CASE OF RATIOTHERAPY IN AN ADULT PATIENT WITH SA EWING IN CHEST WALL
Mosa E.1, Gialousis G.2, Poulinaki E.1, Karelaki C.1, Miliadou A.1, Komi P.1, Grivas A.3, Zampatis C.1, Andreou M.2
1Radiation Oncology Department, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
2Department of Medical Physics, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
3Second Medical Oncology Clinic, General Anticancer Oncology Hospital of Athens «AGIOS SAVVAS»
Introduction: A 43-year-old patient with Sa Ewing of the right lower lobe of the lung, that extended to the right anterior-lateral thoracic wall and to posterior pleura, underwent postoperative adjuvant concurrent chemotherapy-radiotherapy.
Aim: The safe delivery of radiotherapy treatment to an adult patient with Sa Ewing chest wall.
Methods: The patient underwent a wedge lung resection, resection of mediastinum nodules and removal of a chest wall tumor. The histological report revealed «Sa Ewing that extended to the surgical margins of resection of the parietal pleura». Firstly, adjuvant chemotherapy was given and afterwards the patient was scheduled to receive concomitant chemo-radiotherapy. A computed tomography was received with a lung immobilization device. Monaco TPS 5.51 Treatment Planning System was used. Fusion was performed with preoperative magnetic resonance imaging of thorax-upper abdomen, which indicated the disease before surgery and with PET-CT, which confirmed the positive surgical margins. The gross tumor volume (GTV) was delineated according to PET findings, while the area that was defined as subclinical tumor (CTV), was delineated according to preoperative MRI. The planning tumor volume was adjusted by extending the CTV by 1cm, adapting to the surrounding normal tissues. The organs at risk were the heart, the spinal cord, the esophagus, the liver, the kidneys, the unilateral breast and the lungs. QUANTEC 2010 were used to protect OARs. Due to the extensive involvement of the pleural wall, the patient initially received prophylactic radiotherapy throughout the right lung, with a hemithorax technique, with three-dimensional conformal radiotherapy (3DCRT) and a dose of 15Gy/1.5Gy. Then, the patient received volumetric arc therapy (VMAT), with three arcs and a total tumor dose of 45 Gy/1.8Gy at the positive surgical margins area. VMAT treatment was dose checked with SunCheck software, taking images with EPID detector and log files from the linear accelerator, with criteria of 95%/3%/2mm/10%, before and during treatment.
Results: The patient during concomitant chemo-radiotherapy treatment showed only grade II haematological toxicity, with no other side effect.
Conclusions: The radiotherapy treatment of a patient suffered from Sa Ewing of the chest wall IS VERY RARE but it can be safely delivered with a combination of modern radiotherapy techniques.
THREE CASES OF MULTIPLE ENDOCRINE NEOPLASIA TYPE 1 (MEN1) IN AN ONCOLOGY DEPARTMENT
Arvanitou E.1, Gkikas K.1, Malliopoulos D.2, Chatzelis E.3, Koutsikos I.4, Chatziioannou S.5, Tsitsimpis A.1, Michas A.1, Pappas D.6, Gkiaouraki M.1, Ballasis K.1, Christofyllakis Ch.1, Tsoukalas N.1
1Oncology Department, 401 General Military Hospital of Athens, Greece
2Endocrinology Department, 401 General Military Hospital of Athens, Greece
3Endocrinology Department, 251 Air Force General Hospital of Athens, Greece
4Nuclear Medicine Department, 401 General Military Hospital of Athens, Greece
5Biomedical Research Foundation Academy of Athens, Greece
6Pathology Department, 401 General Military Hospital of Athens, Greece
Introduction: Multiple Endocrine Neoplasia type 1 is an autosomal dominant disorder characterized by parathyroid, pancreatic islet and pituitary tumors. Early diagnosis of MEN1 is of utmost importance.
Aim: To present 3 cases of MEN 1 in adult patients from our oncology department.
Cases report: A 42-year-old male with family history of primary hyperparathyroidism presented with hyperparathyroidism, nephrolithiasis and a pancreatic well differentiated, grade 2 NET. Molecular testing showed heterozygous mutation in MEN1 gene (3:c.249_252del). Segmental pancreatectomy and sequential excision of three parathyroid glands followed. Years after presented with masses in anterior mesothorax and in inferior cervical region. Histologies revealed a well differentiated NET like an atypical carcinoid of thymus. A 35-year-old male with known MEN1 (heterozygous mutation in MEN1 gene, 3:c.1126dup) and family history of MEN1 presented with hypercalcemia. Radiological examination showed three pancreatic masses and a small adenoma on adrenal glands, stable in size for eight years since diagnosis. Proper medication for hypercalcemia was administered. A 37-year-old male with known MEN1 (heterozygous mutation in MEN1 gene, 3:c.1126p) and family history of MEN1 presented with masses on pancreas, liver, thyroid and parathyroid glands and a pituitary microadenoma. An EUS-guided pancreas biopsy followed. Histology revealed a high grade NEN. Total parathyroidectomy was performed, and patient received treatment for hypercalcemia.
Conclusions: Clinical suspicion of MEN1 often results from family and medical history. To confirm diagnosis molecular testing is needed. A multidisciplinary approach in specialized centers and genetic counseling are necessary.
FIRST ADMINISTRATION OF TRASTUZUMAB DERUXTECAN (ENHERTU®) IN GREEK PATIENTS WITH GASTROINTESTINAL CANCER: EFFICACY AND SAFETY
Baxevanos P., Floros T.
Athens Naval Hospital
Introduction: Enhertu® is an antibody drug conjugate consisting of trastuzumab (monoclonal antibody against HER2 receptor) linked with 8 molecules of deruxtecan (topoisomerase I inhibitor). It has EMA approval for the treatment of patients with inoperable or metastatic HER2 positive breast cancer, who have received one or more prior anti-HER2-based regimens. Highly promising results have been shown in the phase 2 trials, DESTINY-Gastric01 and DESTINY-CRC01, regarding the efficacy of Enhertu® in patients with HER2 positive gastric and colorectal cancer respectively.
Aim: The presentation of 2 cases of Enhertu® administration in patients with HER2 positive gastric and colorectal cancer, being treated at Athens Naval Hospital. To the best of our knowledge, there is no prior experience with Enhertu® administration in Greece, as there is no current EMA approval for these types of cancer.
Case Presentation: The first patient, 67 years old male, received Enhertu® at the dose of 6.4 mg/Kg as 5th line of therapy, around 2 years after being diagnosed with metastatic HER2 positive gastric adenocarcinoma. After 4 cycles of treatment, significant clinical improvement was noticed as well as major partial response in liver and peritoneal disease. During the first cycle, he presented severe hematological toxicity (febrile neutropenia, thrombocytopenia grade 3) and hemorrhagic ascites, leading to hospitalization for antibiotic treatment and blood transfusions. Thereafter, reduced doses by 20% were administered and no serious toxicity issues occurred. The second patient, 35 years old male, 22 months after the diagnosis of metastatic HER2 positive adenocarcinoma of the sigmoid colon (All RAS wt, BRAF wt, MSS) and failure of the standard chemotherapy regimens with Fluorouracil-Oxaliplatin-Irinotecan-cetuximab-bevacizumab, was given Enhertu® at the dose of 6.4mg/Kg as 3rd line of therapy. His performance status was rapidly improved and the first restaging revealed significant radiological response. There was no toxicity, other than grade 2 emesis.
Conclusions: Enhertu® in patients with gastrointestinal cancer and HER2 amplification/overexpression, that have disease progression after conventional treatments, is effective, safe and could be considered as the best therapeutic option.
ANAL CANCER CHEMORADIOTHERAPY TREATMENT: CORRELATION OF HEMATOLOGICAL TOXICITY WITH RADIATION DOSE TO PELVIC BONE MARROW
Stefanidou C.1, Floros I.1, Spyrakos M.1, Silivridou A.1, Janinis D.2, Vini L.1
1Dept of Radiation Oncology
2Dept of Medical Oncology, Athens Medical Center, Athens
Introduction: For anal carcinomas the primary aim of treatment is to achieve cure with loco-regional control and preservation of anal function with the best possible quality of life. The standard of care is concurrent chemoradiotherapy; Mitomycin-C and 5-FU chemotherapy concurrently with pelvic radiotherapy has been established as the gold standard achieving high rates of local control. With modern radiation techniques (IMRT) acute and long-term genitourinary and intestinal toxicities are reduced. However, treatment-related hematological toxicity has not been properly assessed; chemotherapy suppresses hematopoies is of active bone marrow while radiation therapy causes stromal damage and apoptosis of active stem cells of the bone marrow with in the radiation field.
Aim: The aim of this prospective study is to determine whether there is a correlation between the radiation dose received by pelvic bone marrow with hematological toxicity experienced by some patients during their treatment.
Methods: 29 patients (23 women and 6 men, median age of 61 years) with squamous cell carcinoma of the anal canal were treated with concomitant chemo-radiotherapy in our department in recent years. Radiation therapy was delivered using IMRT (19 patients) and VMAT (10 patients) treatment planning techniques. The radiotherapy field included primary anal disease, pelvic and inguinal lymphnodes. The median dose was 50.4Gy in 28 sessions (with simultaneous boost of 56Gy, total dose, to the primary tumor and involved lymphnodes). Chemotherapy regimen consisted of Mitomyc in C10mg/m2 on day 2 and Capecitabine 825mg/m2 b.i.d. on radiotherapy treatment days. Hematological toxicity was monitored weekly, during treatment, and up to 3 months post-treatment.
Results: Anemia Grade 2 was reported by 6 patients (20%), leukopenia grade 2/3 was reported by 13(44.8%) and thrombocytopenia grade 2/3 was reported by 7 patients (21%). Five patients (17%) had a treatment break of 3 to 23 days due to thrombocytopenia. SPSS Statistics (IBM) program was used for statistic alanalysis. The mean value of bone marrow dose parameters (mean dose, D50%, D30%, D10%) was lower for VMAT treatment plans compared to IMRT plans; the difference, though, was not statistically significant perhaps due to the small sample of patients. However, statistically significant negative correlation was observed between patients’ hematological parameters (WBC, PLT) and bone marrow dose parameters (mean dose, D50% and D30%). In addition, mean dose of ≥30Gy to pelvic bone marrow was associated with a significant increase in the risk of grade3+ hematological toxicity.
Conclusions: The analysis of our data suggests that radiation dose to pelvic bone marrow is individually correlated with hematological toxicity. Pelvic bone marrow should be used as an organ at risk (OAR) and considered during the optimization process of radiotherapy treatment plan in order to reduce hematological toxicity.
THE IMPORTANCE OF LYMPHATIC DRAINING THERAPY FOR CANCER PATIENTS
Hadjiyiasemi K.
University of Nicosia, Pancyprian Organization of Cancer Patients and Friends
Introduction: Lymphedema in carcinogenesis is one of the most common features after lymphadenectomy or lymph node clearance. When a cancer patient develops lymphedema spontaneously his lymphedema is classified as secondary lymphedema. Secondary lymphedema occurs due to mechanical failure of the lymphatic system, this occurs due to reduced lymphatic transport capacity and also the absence of local lymph nodes. Therefore, although the lymphatic load remains at normal levels because it is not transported to the rest of the body, it diffuses into the intercellular space.
Aim: The aim of this review is to present the factors where the management of lymphedema and the ways of treatment are important.
Methods: Articles were searched through Pub med, Medline and Cinahl databases. The review was performed using keywords such as ‘lymphedema, ‘MLD therapy’, ‘cancer’, ‘exercise’ and then using the exclusion and inclusion criteria 27 studies were collected.
Results: In patients with lymphedema, decreased range of motion, changes in skin quality and colour, increase in size and shape of the affected limb were observed. These clinical signs reduce the quality of life and disrupt the mental health of cancer patients. Very important to mention that the characteristics of lymphedema and its rapid onset are an indication of the course of the disease. Therefore, the management of lymphedema is very important for the patient's quality of life but can potentially also be a clinical sign for the patients’ response to their cancer treatment.
Conclusions: 5% of lymphedema occurs in patients with a breast cancer experience. Lymph decongestion with lymphatic drainage techniques, girdling and compressive garments as well as exercise help the tumour site by reducing pressure, the likelihood of ulceration and microbial infections.
MEN 1 SYNDROME COMPLICATED WITH CUSHING SYNDROME
Michas A.1, Arvanitou E.1, Gkikas K.1, Kostaridis E.1, Kagkaras Ch.1, Malliopoulos D.2, Bogiatzidou M.2, Tsitsimpis A.1, Gkiaouraki M.1, Ballasis K.1, Christofyllakis Ch.1, Zagarellos P.2, Tsoukalas N.1
1Oncology Department, 401 General Military Hospital of Athens, Greece
2Endocrinology Department, 401 General Military Hospital of Athens, Greece
Introduction: Multiple Endocrine Neoplasia syndrome I (MEN) is an extremely rare syndrome, associated with truncating mutations of tumor suppressive gene MEN I, located on chromosome 11q13. It is usually related with development of tumors in parathyroid glands, pituitary and pancreas. Cushing syndrome caused by functional malignancies in patients with MEN I, is described exceptionally rare in bibliography. This case-report aims to present a patient with MEN I syndrome under regular oncology evaluation and newly diagnosed Cushing Syndrome.
Case: 42 years old male patient with MEN I syndrome (diagnosed 2013), with medical history of partial pancreatectomy and thymectomy due to development of neuroendocrine tumors (NETs). He was under treatment with somatostatin-receptor analogue and regular oncology evaluation, without clinical sings of relapse for approximately 3 years. Recently, he visited hospital with symptoms of fatigue and weakness. Also he mentioned sensory, visual, audio and memory disturbances in the last weeks. The clinical signs of myopathy were combined with significant hyperglycemia and life-threatening hypokalemia. Hormonal tests revealed high levels of blood and urine-free cortisol. Dexamethazone Suppression Test indicated ACTH ectopic secretion. Imaging findings from PET-CT GA-DOTATATE, PET-CT FDG, CT scans, MRIs, revealed enlarged lymph nodes in mediastinum, liver, and multiple bone metastases. He received treatment with metyrapone and 24hr continuous medical monitoring. Gradually, cortisol levels returned to normal, subsequently correcting patient's metabolic profile. Currently, he is totally functional, under maintenance drug therapy with low-dose metyrapone with future diagnostic and therapeutic interventions planned.
Conclusions: Treatment of patients with MEN syndromes dictates a multidisciplinary approach and medical collaboration. Cushing syndrome due to ectopic secretion of ACTH in patients with MEN 1 is an extremely rare complication that significantly compromises prognosis. Lack of related reports and large clinical trials complicate the diagnostic and treatment approaches, demonstrating the necessity for cooperation and further studies in the future.
BRAIN METASTASES FROM BREAST CANCER: PATIENT SURVIVAL IN RELATION TO MOLECULAL SUBTYPE
Vini L.1, Janinis D.2, Anastasakou K.3, Diamantidou E.4, Touroutoglou N.4
1Dept of Radiation Oncology
2Dept of Medical Oncology
3Dept of Surgical Oncology Athens Medical Center
4Dept of Medical Oncology Interbalkan Medical Center, Thessaloniki.
Introduction: Breast cancer subtypes have been identified with gene profiling studies and can be approximated by immunohistochemistry assays leading to the classification into Luminal A and B, Her-2 positive and triple negative (TN). The Luminal A subtype is associated to the most favorable prognosis, the Luminal B to an intermediate one and the TN and HER-2 positive to fairly unfavorable prognoses, although, concerning HER-2 positive tumours, novel HER-2 targeted therapies, such as trastuzumab or pertuzumab have radically transformed their natural history. Significant heterogeneity also exists in distant relapse patterns as well the behavior of metastatic disease by subtype.
Aim: This is a retrospective study aiming to assess the clinical behavior of metastatic brain disease from adenocarcinoma of the breast in relation to molecular profile of the primary tumour.
Methods: Between 2013–2020, our team treated 52 women with brain metastases from breast adenocarcinoma. Median patient's age at diagnosis of brain recurrence was 53 years (range: 31–78 years), 4 patients had disease only in the brain while the remaining had metastases in other organs as well (liver, lung, bones). The number of brain metastases ranged from 1 to >20. Analysis of the molecular subtypes showed: HR+/HER2- (11patients), HR+/HER2+ (13patients), HR-/HER2+ (18patients), and HR-/HER2- (10 patients). Systemic treatment included chemotherapy, hormonotherapy and targeted therapy for HER2+ disease while the local management for brain disease included surgical resection (9 patients), stereotactic radiotherapy/radiosurgery (29 patients) and whole brain radiotherapy (14patients).
We studied the time interval from initial diagnosis to the development of brain metastases, the brain metastasis free survival (BMFS) and over all survival (OS) from the start of treatment for brain metastases.
Results: Time interval from initial diagnosis to brain metastases development was 56 months for patients with HR+/HER2-, 62 months for HR+/HER2+, 39 months for HR-/HER2+ and 25 months for triple negative tumours (P<.001). BMFS was 11 months for HR+/HER2-, 24 months for HR+/HER2+, 9 months for HR-/HER2+ KAI 7 months for patients with triple negative tumours (P=.06). Overall survival was 22 months for patients with HR+/HER2-tumours, 25 months for HR+/HER2+, 24 months for HR-/HER2+KAI 8 months for those with triple negative tumours (P<.001). Multifactorial analysis of prognostic factors showed that the triple negative tumours had the worst prognosis.
Conclusions: Breast cancer is a disease with a tremendous heterogeneity, which has been understoodand classified. Significant heterogeneity also exists in distant relapse patterns by subtype. The clinical behavior of metastatic brain disease differs significantly among the four molecular subtypes; patient with triple negative tumours experience the worst survival.
COMMUNICATION SKILLS IN MODERN ONCOLOGICAL PRACTICE
Karkaletsos G.
Pathology Oncology Resident, Oncology Clinic, General Hospital of Athens “EVAGGELISMOS”
Introduction: The communication of unpleasant news by the Oncologist to his patients is a decisive event for the doctor-patient relationship. Adequate communication skills of the Oncologist are necessary for the proper communication with the patient.
Purpose: Highlighting the importance of communication skills for the oncologist-patient relationship and the resulting need for training to improve those skills.
Methods: Review of contemporary literature in PUBMED and GOOGLE SCHOLAR databases.
Review Type: Descriptive
Results: An adequate and proper Oncologist-patient communication is associated with the patient's satisfaction by the services provided, his better compliance with medical instructions, the reduction of stress and the optimal understanding of his health condition. Training the oncologist in communication skills increases his confidence in communicating unpleasant news, while reducing the psychological cost to him. To date, there is no generally accepted training program in this field. A model that will define the context of the Oncologist-patient communication and the announcement of bad news, must be developed since it will improve the approach of the patient by his doctor. An Oncologist's inability to have “difficult” conversations with the patient may lead the patient into making decisions that do not reflect what they really want. To adapt the communication approach to each patient, the Oncologist must assess a) the cognitive level of the patients, b) their desire for the completeness of their information, c) emotional perception and d) socio-economic origin, family context and his cultural background. In this way it is possible to maintain a good Oncologist-patient relationship. Finally, bibliography highlights the need to support the above by conducting larger studies on the matter.
Conclusions: The inclusion of learning communication skills in the training curriculum of Oncologists will benefit the Oncologist-patient relationship and communication. What is necessary is the design of further studies, with the aim of a more complete training of Oncologists and the objective recording of the benefit that will arise for patients.
ANGER TUMOR LYSIS SYNDROME AND EPISODE OF MYASTHENIA GRAVIS AFTER CHEMOTHERAPY-CASE STUDY: THE ROLE OF THE NURSE
Papastergiou K.1, Karantsiri M.2, Lavdaniti M.3
1RN, MSc, “Theageneio” Hospital, Thessaloniki
2RN, School Nurse, Thessaloniki
Introduction: According to the World Health Organization, anger cancer is an extremely rare tumor that accounts about 5% worldwide. It appears in the ages of 20–40 years. The 30–40% of cases are accompanied by Gravis Myasthenia.
Aim: The aim of the study was to describe an incident with the onset of tumor lysis after a course of chemotherapy in Anger Cancer.
Methods: This is a case study of a 32-year-old male patient, who underwent chemotherapy, before surgery, in a large hospital in Northern Greece.
Results: A 32-year-old male patient with anger adenocarcinoma underwent in chemotherapy regimen with Endoxan 500mg-Doxorubicin 50mg-Cisplatin 50mg with a chest x-ray that showed satisfactory ventilation. After the end of chemotherapy, the patient developed dyspnea (with SpO2: 92%) in the afternoon, cough and lethargy with blood gases (pCO2:157,6, HCO3-:42,5 KAI pH:7,035). In the clinic, the patient presented the episode of myasthenia gravis with the further worsening of shortness of breath showing superficial and paradoxical breathing with the use of auxiliary muscles. The patient was admitted to the ICU and intubated, while the hematological results showed that the coagulation mechanisms had been affected with D. Dimers: 2540. Elevated CPK: 258 and CRP: 9.1 levels indicated an infection and elevated liver transaminases (SGOT: 60 KAI SGPT: 60) as well as urea and creatinine were slightly elevated. Strong corticosteroid treatment was given, while the patient was monitored, as well as hourly urine measurement and close monitoring of his vital signs every 1 hour. After 4 hours the patient improved respiratory and stabilized with blood gases indicating decreased pCO2: 39,3 KAI pH: 7,46.
Conclusions: The solution of a tumor in the thymus gland with a concomitant episode of myasthenia gravis is a life-threatening side effect of chemotherapy. The patient needs close monitoring in the first 8 hours after the chemotherapy, which is a necessary nursing action to prevent these serious episodes.
RENAL CELL CARCINOMA WITH SARCOMATOID AND RHABDOID DIFFERENTIATION AND METASTASIS TO THE TONSIL
Papadopoulos V., Markou A., Tsapakidis K., Kokkalis A., Chantzara E., Aidarinis C., Lazarou A., Saloustros E., Koinis P., Samaras I., Kotsakis A.
Oncology Clinic, University Hospital of Larisa, University of Thessaly, Greece.
Introduction: The sarcomatoid and rhabdoid(S/R) differentiation may occur in the setting of any renal cell carcinoma (RCC) histology and is considered more of a clonal and morphological evolution in one dedifferentiated biological state than one separate subtype. It has an unfavorable prognosis and most patients develop de novo metastatic disease. These tumors characterized by immune-inflamed phenotype and respond well in treatment with immune checkpoint inhibitors (ICI) [1]. While metastases to the head and neck from RCC are rare, to the tonsil they are even rarer [2].
Aim: The presentation of a clinical case of a patient with response to ICI and rare metastasis to the tonsil.
Case Presentation: A 59-year-old patient with a left kidney mass and bone metastases in the spine with threatened spinal cord compression. He underwent emergency radiation therapy to the spine and subsequently on left nephrectomy which revealed RCC with S/R differentiation and few clear cells. The patient's disease was intermediate risk and he was started on treatment with Ipilimumab and Nivolumab. While the disease showed a partial response, after 6 months the patient presented with dysphagia due to left tonsil swelling. A tonsillectomy was performed and it was confirmed to be a metastasis from the RCC. Nivolumab treatment was continued and after 5 months, an immune-mediated nephrotic syndrome developed. Immunotherapy was stopped and prednisolone treatment was administered. After the nephrotic syndrome has resolved, the disease remained stable and Nivolumab rechallenge treatment was administered with no other adverse events. Since the disease has remained stable for a long time, liver metastases occurred. Treatment was then changed to an anti-VEGF TKI without response.
Conclusions: RCC with S/R differentiation have specific clinical, molecular and genetic features and exhibit aggressive clinical behavior and poor prognosis. Because of their immune-inflamed microenvironment respond to ICI therapy.
References:
Bakouny Z, Braun DA, Shukla SA, et al. Integrative molecular characterization of sarcomatoid and rhabdoid renal cell carcinoma. Nat Commun. 2021;12(1):808. Published 2021 Feb 5. doi:10.1038/s41467-021-21068-9.
Z BakounyDA BraunSA ShuklaIntegrative molecular characterization of sarcomatoid and rhabdoid renal cell carcinomaNat Commun2021121808Published 2021 Feb 5.10.1038/s41467-021-21068-9
Ellis SD, Meikle A, Al-Salti W, Sinclair G. Rare case of clear cell renal cell carcinoma presenting as a unilateral tonsil lesion. BMJ Case Rep. 2020;13(12):e237941. Published 2020 Dec 10. doi:10.1136/bcr-2020-237941.
SD EllisA MeikleW Al-SaltiG SinclairRare case of clear cell renal cell carcinoma presenting as a unilateral tonsil lesionBMJ Case Rep20201312e237941Published 2020 Dec 10.10.1136/bcr-2020-237941
A MAN DIAGNOSED WITH THREE DIFFERENT TYPES OF LUNG CANCER
Andreadou A.1, Molyva D.2, Bleka E.2, Sinduka E.3, Gerasimidou R.4, Andreadis Ch.5
1Medical oncologist Theagenio hospital, 3rd department
2Intern medical oncology Theagenio hospital, 3rd department
3Consultant, radiologist Theagenio hospital,
4Consultant pathology department Theageneio hospital
5Medical oncologist, Chair of 3rd Clinic Theagenio Hospital
Introduction: Smoking is the main cause of lung cancer. Seventy percent of the cases are attributed to smoke which contains about sixty toxic substances. Besides the progress that has been seen in the field of oncology, the prognosis is poor, especially for small cell carcinoma.
Case report: A sixty-four-year-old man due to difficulty in swallowing, fatigue and weight loss was diagnosed with localized small cell lung cancer in 2013. The CT showed a paraesophageal mass 10 cm × 5cm × 5.7 cm. The disease was visible through the oesophagus from where the biopsy was taken. The patient after 6 cycles of chemotherapy with cisplatin – etoposide and 60 Gy of radiotherapy to the field of the tumor had complete resolution of the tumor and remained on follow up. The patient stopped smoking and the CTs were normal till 2020 were two new lesions appeared.
The PET-CT did not show any other abnormal findings and in October 2020 the nodule pf the right lower lobe was removed. The histopathology findings were compatible with adenocarcinoma T1bNx. Later, in March 2021 the lesion of th upper left lobe was removed and the biopsy showed that it was squamous cancer T1bNx.
The patient till now has regular CTs and is disease free.
Conclusions: The risk of a new lung cancer in patients with a history of lung cancer remains high even if the patient stops smoking. The case we chose to discuss depicts the rare case of a man that although he survived from small cell lung cancer, he was diagnosed again with different types of cancer eight years later.
LARGE-CELL LUNG CARCINOMA: A CASE REPORT OF A PATIENT WITH LONG SURVIVAL
Markou A., Tsapakidis K., Papadopoulos V., Kokkalis A., Saloustros E., Koinis F., Samaras I., Chantzara E., Aidarinis X., Lazarou A., Kotsakis A.
Department of Medical Oncology, University Hospital of Larisa, Larisa, Greece
Introduction: Giant cell carcinoma of the lung is a rare, undifferentiated histological form of non-small cell lung cancer. It belongs to sarcomatoid lung carcinomas and accounts for less than 1% of all lung carcinomas (1). It has a strong association with smoking and the median age of diagnosis is 59 years of age (2).
Aim: To present the case of a female patient with recurrence of a previously excised giant cell carcinoma of the lung who has achieved a disease free survival (DFS) of 2 years until this day.
Case report: A never smoker 74-year old female patient with history of excision of a giant cell carcinoma of the upper lobe of the left lung, visited the outpatient clinic 7 months ago. Due to anemia she already had an endoscopy which revealed a mass to the small intestine. The histology from the biopsy showed a recurrence from the previous giant cell carcinoma of the lung. From the imaging that followed there were no metastases and the patient had the mass excised. The patient received 6 cycles of adjuvant chemotherapy with gemcitabine and carboplatin. The PET/CT scan that took place 6 months after the adjuvant chemotherapy, was positive for mediastinal lymph nodes (SUVmax: 7). Due to the aggressiveness of this particular histologic subtype and with the excellent overall response of the patient to the previous therapies, she received radiation therapy to the mediastinum. Today, 2 years after the radiation therapy, the patient remains disease free.
Conclusions: Due to the rarity of giant cell tumor of the lung, we believe that this case report contributes to the collection of data for the efficacy of the current treatment of choice with gemcitabine and carboplatin (3). Furthermore, it highlights the importance of the multidisciplinary collaboration of different specialties such as surgeons, oncologists and radiation oncologists for optimum outcome.
MANAGEMENT OF OLIGOMETASTATIC PROSTATE CANCER, WITH LOW GLEASON SCORE, IN THE LUNG
Tsapakidis K., Papadopoulos V., Markou A., Kokkalis A., Chantzara E., Aidarinis C., Lazarou A., Saloustros E., Koinis F., Samaras I., Kotsakis A
Department of Medical Oncology, University General Hospital of Larissa, Larissa, Greece
Introduction: Prostate cancer is the second most common cancer in men worldwide, as the clinical use of prostate specific antigen (PSA) leads to increased prostate cancer detection (1). Metastatic prostate cancer recurrence after definitive local therapy can occur in any tissue with bone and regional lymph nodes being the most common metastatic site (2).
Aim: A clinical case of prostate cancer with low Gleason score with solitary lung metastasis from prostate cancer with a disease-free interval of 7 years and no extrapulmonary metastases that was treated as oligometastatic disease.
Case report: The case refers to a 72 year-old, Caucasian, ex-smoker male patient who underwent radical prostatectomy and bilateral lymphadenectomy in 2010 for a Gleason 7 (4+3) prostate adenocarcinoma, extra-capsular extension and post-operative undetectable PSA level (0,002 ng/ml). The patient did not receive any adjuvant treatment and 7 years later, due to an increase of PSA level (0.9 ng/ml) he underwent screening, revealing only a solitary lung nodule. The patient underwent a thoracoscopic radical resection, with the histological examination and the histopathological review confirming the diagnosis prostate cancer relapse. Based on these results the patient did salvage RT to the prostatic bed and received six months of Androgen Deprivation Therapy (ADT) with normalization of the PSA level and 3 years now he is alive without evidence of disease.
Conclusions: Lung metastasis is present in more than 40% of men with metastatic prostate cancer (2), but lung metastases without any bone or lymph node involvement and low Gleason score are extremely rare and only a handful of cases are reported in the literature (3). Elevation of the PSA level generally precedes the radiologic findings of local or distant recurrence (biochemical recurrence) and surgical resection is the optimal treatment with patients having long survival (4).
VASCULAR DISEASE IN A PATIENT WITH A GERM CELL TUMOR
Gkikas K.1, Arvanitou E.1, Michas A.1, Kostaridis E.1, Kagkaras Ch.1, Zouraris D.1, Gkiaouraki M.1, Ballasis K.1, Nikou E.2, Papoutsis K.3, Psarogiorgou S.4, Christofyllakis Ch.1, Tsoukalas N.1
1Oncology Department, 401 General Military Hospital of Athens
21st Surgery Clinic, 401 General Military Hospital of Athens
3Vascular Surgery Clinic, 401 General Military Hospital of Athens
4Anatomical Pathology Laboratory, 401 General Military Hospital of Athens
Introduction: The association between cancer and vascular disease (especially thromboembolic disease) has been known for decades. Most common causes are both the hypercoagulable state of malignancy as well as some certain chemotherapy drugs.
Aim: To present the vascular disease that occurred in a patient with a germ cell tumor.
Case report: A 35-year-old male patient came to the ER complaining of left lower limb pain (gastrocnemius muscle) and was diagnosed with DVT. A pulpable abdominal mass was also found so he was hospitalized in the Internal Medicine Department. The diagnostic imaging tests also depicted suspicious masses within the liver and the lungs, while blood tests revealed a major increase of the AFP serum levels. The biopsy of the abdominal mass showed a yolk sac tumor. The patient went through 4 rounds of BEP chemotherapy with good response and tolerance. During chemotherapy process, the patient was also diagnosed with a femoral artery thrombosis and underwent an embolism. A few days later, a sudden swelling of his right lower leg revealed a second case of DVT. In both incidents, the anticoagulant treatment was modified. Eventually, the MRI revealed a residual post-chemotherapy mass, so the patient underwent surgery. The biopsy showed a different germ cell tumor histopathological type (rhabdomyosarcoma). Therefore, the patient undergoes a second-line therapy with a combination of ifosfamide and anthracycline.
Conclusions: Thrombosis is very common among cancer patients and tends to appear either early or late throughout chemotherapy process. Constant attention and early observation of thrombosis-related symptoms and signs can lead to effective avoidance of dangerous complications.