Table 1
Real-time PCR primer sequences and conditions
| Target gene (host) | GenBank no. accession | Primers (sense, antisense) | Tm (°C) | bp |
|---|---|---|---|---|
| GADPH (R. norvegicus) | NM_017008 | Fw 5’-CTGCTCCTCCCTGTTCTAGAGACA-3’ Rv 5’-CCGATACGGCCAAATCCGTTCACA-3’ | 58 | 105 |
| PrPC (H. sapiens) | NM_000311.3 | Rv 5’-CTCCCAGTCGTTGCCAAAAT -3’ Fw 5’-AACCTCAAGCATGTGGCAGG-3’ | 56 | 117 |
| KDR (H. sapiens) | NM_002253 | Rv 5’- GGCTCTTTCGCTTACTGTTC -3’ Fw 5’- TGCCTACCTCACCTGTTTC -3’ | 62 | 114 |
| Flt-1 (H. sapiens) | NM_002019 | Rv 5’-GGTGTGCTTATTTGGACATC-3’ Fw 5’-CGTAGAGATGTACAGTGAAA-3’ | 58 | 306 |

Figure 1
Effect of transfection on cell viability. HUVEC cells seeded in 96 multi-well plates were transfected with the 30 nM siRNA/siPORT NeoFX complexes, using a variable amount of the lipid agent (0.15-75 μl). After 72h, cell viability was quantified by MTT test; experimental replicates n = 3. The ANOVA statistical test did not reveal significant differences between the measured average values.

Figure 2
Analysis of the PrP transcript levels. (a) Real Time PCR analysis of the PrP transcript levels was performed in total RNA samples extracted from control (ctrl) e transfected cells at 48h with siRNA s11212 e s11213, administered separately or simultaneously (siRNA mix, control internal: GADPH, experimental replicates n = 3). (b) Western blot analysis of prion protein levels performed on transfected cellular extracts at 48h (internal control: β -actin) (c).

Figure 3
Effect of PrPC protein expression on the copper-induced cytotoxicity profile. Control and PrPKD HUVEC cells were treated for 24h with increasing concentrations of copper. The percentage of viable cells, estimated by MTT assay, is compared to the control condition (no treatment). The EC50 (half maximal effective substrate concentration) values belong to each of the dose-response curves and were evaluated using GraphPad Prism 5.0 software; the values in the graph are reported as mean ± SE and were compared by Student’s t test (n = 3; ** p <0.01).

Figure 4
Membrane Cu2+-reductase activity in HUVEC Ctrl and knockdown PrPKD. Copper ions accumulation in culture medium has been evaluated via colorimetric assay of the Cu/BCS complex (482 nm). Data are reported as mean ± SE (n=3; **p < 0.01).

Figure 5
Endocytosis inhibitors effect on the copper accumulation in the HUVEC cells. (a) HUVEC cells have been pre-treated with Cytochalasin B (Cyt B; 100 μg/ml), Chlorpromazine (CPZ; 50 μM), or exposed to hypertonic shock (Hyper) for 15 min, before being dyed with Phen Green SK fluorescent indicator and exposed to a Cu-His2 concentration of 20 μM. (b) Cytochalasin B scalar concentrations effect on the ion copper uptake (Cu-His2 20 μM; n=3, *p<0.05). (c) Cytochalasin B effect on the copper uptake in HUVEC Ctrl and PrPKD cells. (n=3; ANOVA, **p<0.01).

Figure 6
Spheroid formation assay. Representative images showing Spheroids’ growth obtained from HUVEC PrPKD and scrambled siRNAs cells at 16, 24 and 48 h. Images were taken with a 20X objective.

Figure 7
Spheroid-derived cell vitality assay. Cells derived from control (Ctrl) and knockdown (PrPKD) spheroids mechanically detached and counted at the given timepoints have been dyed with Trypan Blue 0,2% in order to discriminate viable cells. The graph shows vitality percentage relative to the number of cultured cells counted in Ctrl spheroids after 16h. (n=3; *p < 0.05).

Figure 8
VEGF-induced tubulogenesis assay in Matrigel. HUVEC control (a-b) and PrPKD (d-e) seeded on Matrigel and stimulated for 16h. Images (c) and (f ), relative to network analysis are performed by WimTube software (Wimasis GmbH, Germany). Histograms (g) are respectively referred to coverage area, tubules and knots; data reported are related to statistical analysis of images acquired in three independent experiments (* p <0.05).

Figure 9
Flt-1 and KDR receptors transcript levels in Ctrl and PrPKD cells. Graphs show Flt-1 and KDR receptors transcript levels in HUVEC Ctrl and PrPKD cells. RT-PCR results have been normalized on GADPH transcript levels (n=3).