Skip to main content
Have a personal or library account? Click to login
Monogenic Findings in Early Pregnancy Loss: Whole-Exome Sequencing Study of Euploid Products of Conception Cover

Monogenic Findings in Early Pregnancy Loss: Whole-Exome Sequencing Study of Euploid Products of Conception

Open Access
|May 2026

Full Article

INTRODUCTION

Early pregnancy loss (EPL) is defined as spontaneous pregnancy loss before 12 completed gestational weeks. Its etiology is multifactorial, involving genetic, anatomic, endocrine, immunological, and environmental factors. Chromosomal abnormalities account for approximately 50–60% of EPLs, with trisomy being the most common, followed by monosomy × and triploidy [ 1, 2, 3]. These aberrations are typically de novo, and recurrence risk is generally not elevated in the couples.

Recurrent pregnancy loss (RPL), defined as two or more consecutive early losses, affects up to 5% of couples. Compared with sporadic losses, chromosomal abnormalities are less frequent in RPL, suggesting that additional genetic mechanisms may contribute [4].

While the contribution of chromosomal anomalies is well established, the role of monogenic disorders in euploid EPL remains incompletely defined. The advent of next-generation sequencing technologies, particularly whole-exome sequencing (WES), has expanded the capacity to detect pathogenic variants underlying Mendelian disease. WES enables identification of the majority of coding disease-causing variants and has become an essential tool in rare disease diagnostics [5, 6].

However, only a limited number of studies have applied WES to POCs from early losses, and many included heterogeneous gestational ages or selected fetuses with ultrasound-detected anomalies. Consequently, the prevalence and spectrum of monogenic causes in typical first-trimester euploid EPL remain insufficiently characterized.

Recent studies that applied WES to POCs have reported pathogenic or likely pathogenic variants in genes implicated in a broad spectrum of disorders, including multisystem developmental syndromes, cardiac malformations, skeletal dysplasia, kidney disorders, and central nervous system abnormalities [7, 8, 9, 10, 11]. These findings support the hypothesis that a subset of early pregnancy losses may be attributable to rare, deleterious variants in genes critical for early embryonic development.

In this study, we analyzed 66 euploid POCs from EPL occurring exclusively before 12 gestational weeks using WES. By focusing on this carefully defined cohort, we aimed to assess the prevalence and biological spectrum of potentially pathogenic variants contributing to early embryonic demise.

MATERIALS AND METHODS

EPL tissue samples

WES was performed on 66 euploid POCs derived from 60 unrelated couples. In six families, two losses were analyzed. Gestational age ranged from 6 to 12 weeks (mean 8.23 ± 1.25), and maternal age ranged from 20 to 42 years (mean 30.9 ± 5.18). Couples reported 2–13 prior losses (mean 3.56 ± 2.14) and 0–2 live births (0.28 ± 0.57). Of the POCs, 34 were male and 32 female (M:F = 1.09:1); 32 originated from Macedonian and 34 from Albanian families. Full demographic and clinical details are provided in Supplementary Table S1.

DNA extraction, maternal-cell contamination testing, and chromosomal screening

Genomic DNA was extracted from two to three chorionic villus fragments or fetal tissue of approximately 2 mm2 using the MagCore Super automated nucleic-acid extractor (RBC Bioscience). An in-house QF-PCR assay, targeting short tandem repeats on chromosomes 13, 18, 21, X, and Y, was applied to exclude maternal-cell contamination and detect triploidy [12, 13, 14]. MLPA (MRC-Holland) subtelomeric probe mixes were used to screen for numerical or large structural chromosomal anomalies [2, 3]. Samples negative by both assays proceeded to WES.

Whole-exome sequencing, variant prioritization, interpretation strategy, and confirmation

Libraries were prepared with the Twist Human Core + RefSeq + Mitochondrial panel (Twist Bioscience) and sequenced on an Illumina NovaSeq 6000 with 2 × 100 bp paired-end reads. Reads were aligned to the GRCh38 reference genome using BWA-MEM v0.7.15 [15]. The mean on-target depth exceeded 100x, with at least 98% of bases covered at >=10x. Single-nucleotide variants (SNVs) and small insertions/deletions (indels) were called using GATK v4.3 HaplotypeCaller with 25 bp exon padding and annotated with Ensembl VEP v106 [16,17]. CNV analysis was performed on exome depth-of-coverage data using the CeGaT pipeline; only high-confidence, clinically relevant CNVs were considered reportable, and clinically relevant CNVs were validated by array comparative genomic hybridization (4x180k, Oxford Gene Technologies/Agilent Technologies) and/or MLPA.

Variants were classified according to American College of Medical Genetics and Genomics ACMG/AMP guidelines as pathogenic, likely pathogenic, variant of uncertain significance (VUS), likely benign, or benign [18]. Analysis was performed exome-wide rather than being restricted to a predefined gene list, with prioritization of rare coding and splice-site variants in genes. Variant review incorporated population frequency, predicted functional consequence, known gene-disease validity, expected inheritance model, segregation data when available. Population-frequency assessment relied on gnomAD v2.1.1 and v4.0 and an internal dataset of 1513 WES samples. Variants above the allele-frequency thresholds used in our diagnostic pipeline were generally deprioritized unless previously established as pathogenic.

Clinical significance was assessed using Franklin (Genoox) and VarSome, followed by manual curation. All reported P/LP variants and selected VUS discussed as possible contributors were confirmed by Sanger sequencing. Primers designed with Primer3 and PCR conditions are listed in Supplementary Tables S2 and S3. Parental studies were performed in all cases, using Sanger sequencing, MLPA, or arrayCGH as appropriate. QF-PCR was the principal method used to exclude maternal-cell contamination and triploidy.

RESULTS

Diagnostic yield

Whole-exome sequencing (WES) was performed on 66 euploid products of conception (POCs) from early pregnancy losses (EPLs) occurring before 12 gestational weeks. A molecular diagnosis, defined as pathogenic or likely pathogenic (P/LP) variant(s) consistent with the expected mode of inheritance, was established in 13/66 POCs (19.7%), including one large de novo 21q22.12-q22.3 duplication encompassing DYRK1A and RUNX1.

An additional 9/66 POCs (13.6%) harbored findings considered possible monogenic contributors rather than definitive diagnoses. The remaining 44/66 cases (66.7%) had no reportable variant. Figure 1 summarizes the overall classification of cases represented among reportable findings.

Figure 1.

Overview of molecular findings in 66 euploid early pregnancy losses. Diagnostic summary showing cases with a genetic diagnosis, possible monogenic contribution (VUS + P/VUS), and no reportable variant, with autosomal recessive (AR) and autosomal dominant (AD) findings indicated where applicable

Interpretive categorization

To reduce overinterpretation, reportable findings were further stratified into three categories: (1) genes plausibly associated with prenatal or early embryonic lethality, (2) genes causing severe congenital disorders not typically considered embryonically lethal, and (3) genes linked to later-onset or susceptibility phenotypes. Detailed molecular data and this interpretive framework are summarized in Tables 1 and 2. Figure 2 provides an overview of the reportable findings according to interpretive category and the major developmental or organ systems represented.

Table 1.

Detailed overview of variants detected by WES in euploid EPL and their molecular characteristics

CaseGeneReference sequenceVariantProtein changeZygosityInheritanceType of variantKnown / NovelACMG classificationACMG criteria
1. Genes plausibly associated with prenatal or early embryonic lethality
Definitive molecular diagnoses
Abp-411CPLANE1NM_001384732.1c.1819delT;7817T>Ap.Tyr607ThrfsTer6; p.Leu2624TerhomM/FFrameshiftKnownPathogenicPVS1; PM2; PP5/PVS1; PM2; PP5
Abp-445 1CPLANE1NM_001384732.1c.1819delT;7817T>Ap.Tyr607ThrfsTer6; p.Leu2624TerhetFFrameshift; NonsenseKnownPathogenicPVS1; PM2; PP5/PVS1; PM2; PP5
c.5820+3_5820+6delexon 29 skippinghetMSplice siteNovelPathogenicPS3, PM2; PM3; PM4; PP3
Abp-4942DHCR7NM_001360.3c.452G>Ap.Trp151TerhetFNonsenseKnownPathogenicPVS1; PM2; PP5
c.964-1G>Caltered splicinghetMSplice siteKnownPathogenicPVS1; PM2; PP5
Abp-5452DHCR7NM_001360.3c.452G>Ap.Trp151TerhetFNonsenseKnownPathogenicPVS1; PM2; PP5
c.964-1G>Caltered splicinghetMSplice siteKnownPathogenicPVS1; PM2; PP5
Abp-5511CPLANE1NM_001384732.1c.1819delT;7817T>Ap.Tyr607ThrfsTer6; p.Leu2624TerhetFFrameshift; NonsenseKnownPathogenicPVS1; PM2; PP5/PVS1; PM2; PP5
c.5820+3_5820+6delexon 29 skippinghetMSplice siteNovelPathogenicPVS1; PM2; PP5/PVS1; PM2; PP5
Possible monogenic contributors
Abp-501GBA1NM_000157.4c.1444G>Tp.Asp482TyrhetMMissenseKnownVUSPM2; PM3; PP3
c.1226A>Gp.Asn409SerhetFMissenseKnownLikely pathogenicPM1; PM2; PM5; PP2; PP3; PP5
Abp-694PKHD1NM_138694.4c.107C>Tp.Thr36MethetMMissenseKnownLikely pathogenicPM2; PM5; PP3; PP5
c.10883C>Tp.Thr362IlehetFMissenseKnownVUSPM2; PM3
Abp-825RPGRIP1LNM_015272.5c.2771G>Ap.Ser924AsnhetMMissenseKnownVUSPM2, PM3
c.3295-2A>G/hetFSplice siteKnownLikely pathogenicPVS1; PM2; PP5
2. Genes causing severe congenital disorders not typically considered embryonically lethal
Definitive molecular diagnoses
Abp-251SLC6A1NM_003042.4c.740C>Ap.Pro247Hishetde novoMissenseNovelLikely pathogenicPM2; PM5; PP2; PP3
Abp-716RBM8ANM_005105.5c.-21G>A/hetMMissense/noncodingKnownPathogenic, low penetrancePS3, PM3
1q21.1-q21.2hg19chr1:143,767,833-149,400,542/hetFDeletionKnownPathogenic2A; 3B; 4L >1 point
Abp-799NF1NM_001042492.3c.4600C>Tp.Arg1513TerhetFNonsenseKnownPathogenicPVS1; PM2; PP5
Abp-801DSG2NM_001943.5c.2315delp.Leu772TerhetMNonsenseNovelLikely pathogenicPVS1; PM2
Abp-825DVL1NM_001330311.2c.1961dupp.Pro657AlafsTer50hetFFrameshiftNovelLikely pathogenicPVS1; PM2
Possible monogenic contributors
Abp-80PAHNM_000277.3c.842C>Tp.Pro281LeuhetMMissenseKnownPathogenicPS3, PM2; PM5; PP2; PP3; PP5
c.*19G>T/hetFMissense/noncodingKnownVUSPM3; BS1; BS2; BP7
Abp-87PRDM6NM_001136239.4c.1057G>Ap.Asp353AsnhetMMissenseKnownVUSPM2
Abp-166TBX18NM_001080508.3c.1570C>Tp.His524TyrhetMMissenseKnownVUSPM2; PP3; PP5
Abp-233SCN5ANM_000335.5c.3911C>Tp.Thr1304MethetFMissenseKnownVUSPM2, PP3, PP5
Abp-577TSC1NM_000368.5c.3113_3119delp.Ser1038ThrfsTer51hetFFrameshiftNovelVUSPVS1(moderate); PM2
Abp-781MYH3NM_002470.4c.3137G>Ap.Arg1046GlnhetMMissenseKnownVUSPM2; PP3
3. Genes linked to later-onset or susceptibility phenotypes
Abp-668VWFNM_000552.5c.3797C>Tp.Pro1266LeuhetMMissenseKnownLikely pathogenicPM1; PM2; PM5; PP5
Abp-809F5NM_000130.5c.1601G>Ap.Arg534GlnhomM (hom)/F (het)MissenseKnownPathogenic, low penetrancePS3, PS4
Additional distinct pathogenic copy-number finding
Abp-97221q22.12-q22.3duphg19chr21:33,398,108-43,587,648/hetde novoDuplicationKnownPathogenic3C; 4L >1 point

1,2 fetuses from same family. Abp-825 harbored two distinct reportable findings assigned to different interpretive categories: a heterozygous likely pathogenic DVL1 variant and a biallelic RPGRIP1L finding composed of one likely pathogenic splice-site variant and one missense VUS.

Table 2.

Zygosity, inheritance, OMIM-associated diseases, and interpretive grouping of the detected genes

CaseGeneVariantAccession numberAF (gnomAD)Internal frequencyOMIM disease/s; InheritanceMajor developmental / organ system
1. Genes plausibly associated with prenatal or early embryonic lethality
Definitive molecular diagnoses
Abp-411CPLANE1c.1819delT;7817T>Ars777686211; rs7495237550.0001554; 0.000023900.0077614615, Joubert Syndrome 17, AR; 277170, Orofaciodigital syndrome VI, ARMulti-system
Abp-4451CPLANE1c.1819delT;7817T>Ars777686211; rs7495237550.0001554; 0.000023900.0077614615, Joubert Syndrome 17, AR; 277170, Orofaciodigital syndrome VI, ARMulti-system
c.5820+3_5820+6del//0.0017
Abp-4942DHCR7c.452G>Ars115552170.00077590.0084270400, Smith-Lemli-Opitz syndrome, ARMulti-system
c.964-1G>Crs1386591670.0038540.0042
Abp-5452DHCR7c.452G>Ars115552170.00077590.0084270400, Smith-Lemli-Opitz syndrome, ARMulti-system
c.964-1G>Crs1386591670.0038540.0042
Abp-5511CPLANE1c.1819delT;7817T>Ars777686211; rs7495237550.0001554; 0.000023900.0077614615, Joubert Syndrome 17, AR; 277170, Orofaciodigital syndrome VI, ARMulti-system
c.5820+3_5820+6del//0.0017
Possible monogenic contributors
Abp-501GBA1c.1444G>T//0608013, 230800, 230900, 231000, 231005, Gaucher disease types perinatal death, I, II, III, IIIC, ARMulti-system
c.1226A>Grs767637150.0022350.0067
Abp-694PKHD1c.107C>Trs1378529440.00050940.0014263200, Polycystic kidney disease 4, with or without hepatic disease, ARKidney anomalies
c.10883C>Trs1477006430.000053120
Abp-825RPGRIP1Lc.2771G>Ars142234650/0611561, Meckel syndrome 5, AR; 611560, Joubert syndrome 7, ARCiliopathies/multi-system
c.3295-2A>Grs1258182460/0
2. Genes causing severe congenital disorders not typically considered embryonically lethal
Definitive molecular diagnoses
Abp-251SLC6A1c.740C>A//0616421, Myoclonic-atonic epilepsy, ADNeurologic
Abp-716RBM8Ac.-21G>Ars1394282920.01794>2%274000, Thrombocytopenia-absent radius syndrome, ARMulti-system
1q21.1-q21.2chr1:143,767,833-149,400,542//0
Abp-799NF1c.4600C>Trs7607035050.0000079570162200, Neurofibromatosis, type 1, ADMulti-system
Abp-801DSG2c.2315del//0610193, Arrhythmogenic right ventricular dysplasia 10, ADCardiac
Abp-825DVL1c.1961dup//0616331, Robinow syndrome, autosomal dominant 2, ADSkeletal
Possible monogenic contributors
Abp-80PAHc.842C>Trs50308510.00010260.0010261600, Phenylketonuria, ARMetabolic
c.*19G>Trs3726370210.0020290
Abp-87PRDM6c.1057G>Ars2022247620.00026040.0010617039, Patent ductus arteriosus 3, ADCardiac
Abp-166TBX18c.1570C>Trs7609055890.0000080610.0010143400, Congenital anomalies of kidney and urinary tract 2, ADKidney anomalies
Abp-233SCN5Ac.3911C>Trs1994736030.00016490601144, Brugada syndrome 1, AD; 601154, Cardiomyopathy, dilated, 1E, AD; 603830, Long QT syndrome 3, ADCardiac
Abp-577TSC1c.3113_3119del//0.00035191100, Tuberous sclerosis-1, ADMulti-system
Abp-781MYH3c.3137G>Ars1420024490.00040310.0010193700, Arthrogryposis, distal, type 2A (Freeman-Sheldon), ADSkeletal
3. Genes linked to later-onset or susceptibility phenotypes
Abp-668VWFc.3797C>Trs617493700.00083220.0010193400, von Willebrand disease, AD/ARBlood
Abp-809F5c.1601G>Ars60250.01752>3%188055, Thrombophilia 2 due to activated protein C resistance, AD; 614389, {Pregnancy loss, recurrent, susceptibility to, 1}, ADBlood
Additional distinct pathogenic copy-number finding
Abp-972 [U]21q22.12-q22.3chr21:33,398,108–43,587,648//0/, 21q22 Duplication SyndromeMulti-system

1,2 fetuses from same family. Abp-825 harbored two distinct reportable findings assigned to different interpretive categories: a heterozygous likely pathogenic DVL1 variant and a biallelic RPGRIP1L finding composed of one likely pathogenic splice-site variant and one missense VUS.

Figure 2.

Overview of the identified genetic findings grouped by major developmental or organ-system association. (A) Genetic diagnoses, including definitive molecular diagnoses, and the pathogenic copy-number finding 21q22.12-q22.3 duplication. (B) Possible monogenic contributors. Genes are mapped to their principal affected systems, including neurologic, cardiac, blood/coagulation, kidney anomalies, skeletal, metabolic, ciliopathies, and multi-system involvement. CPLANE1 and RPGRIP1L are shown in both ciliopathy and multi-system categories because of their broader phenotypic effects.

Segregation findings according to interpretive categorization

Among genes plausibly associated with prenatal or early embryonic lethality, molecular diagnoses were identified in cases with biallelic pathogenic variants in CPLANE1 and DHCR7, while additional potential monogenic contributors included biallelic combinations in GBA1, PKHD1, and RPGRIP1L. Parental testing was available in all cases and confirmed biparental inheritance in recessive findings. Pedigree analysis of families with definitive molecular diagnoses and, in selected cases, recurrent affected pregnancy losses (Figure 3).

Figure 3.

Pedigrees of families with definitive molecular diagnoses in the euploid early pregnancy loss cohort, grouped according to interpretive category. Previous losses, livebirths, and affected fetuses are shown for each family, and recurrent affected fetuses are integrated into the same pedigree when present.

Among genes causing severe congenital disorders not typically considered embryonically lethal, molecular diagnoses consisted of heterozygous variants in SLC6A1, NF1, DSG2, DVL1, and one RBM8A-associated case with the characteristic combination of the low-penetrance regulatory variant and the recurrent 1q21.1-q21.2 deletion. The potential contributory subset included heterozygous VUS in MYH3, PAH, PRDM6, SCN5A, TBX18, and TSC1. All heterozygous variants were inherited from one parent, with exception of SLC6A1: c.740C>A which occurred de novo; parental phenotypic information was not available.

Among genes linked to later-onset or susceptibility phenotypes, reportable findings included homozygous F5: c.1601G>A and heterozygous VWF: c.3797C>T variants.

One de novo 21q22.12-q22.3 duplication represented a distinct pathogenic copy-number diagnosis.

Variant spectrum and predicted molecular consequences according to interpretive categorization

Genes plausibly associated with prenatal or early embryonic lethality.

This category was dominated by biallelic truncating and splice-disrupting variants in CPLANE1 and DHCR7, which led to molecular diagnosis. A notable finding was the novel CPLANE1: c.5820+3_5820+6del variant, previously shown to disrupt splicing and cause exon skipping. Potential contributory cases included compound-heterozygous P/LP and VUS combinations in GBA1, PKHD1, and RP-GRIP1L, highlighting missense variants such as GBA1: p.Asp482Tyr and p.Asn409Ser, PKHD1: p.Thr36Met and p.Thr362Ile, and RPGRIP1L: p.Ser924Asn.

Genes causing severe congenital disorders not typically considered embryonically lethal

This category was dominated by simple heterozygous findings. Several novel variants were identified, including SLC6A1: p.Pro247His, DSG2: p.Leu772Ter, DVL1: p.Pro657AlafsTer50, NF1: p.Arg1513Ter, while the RBM8A-associated case reflected the expected combination of the low-penetrance regulatory variant and the recurrent 1q21.1-q21.2 deletion. Additional potential contributory findings were mainly heterozygous missense VUS variants, including MYH3: p.Arg1046Gln, PRDM6: p.Asp353Asn, TBX18: p.His524Tyr, and SCN5A: p.Thr1304Met, TSC1: p.Ser1038ThrfsTer51 and PAH: p.Pro281Leu.

Genes linked to later-onset or susceptibility phenotypes

This category included missense variants in F5 and VWF, namely F5: c.1601G>A (p.Arg534Gln) and VWF: c.3797C>T (p.Pro1266Leu).

Copy number variants (CNV)

Structural alterations across the reportable cohort also included the 1q21.1-q21.2 deletion in the RBM8A-associated case and the de novo 21q22.12-q22.3 duplication involving DYRK1A and RUNX1.

Predicted molecular consequences

Predicted effects were consistent with variant class: truncating variants are expected to cause loss of function, and splice-site variants such as DHCR7: c.964-1G>C, RPGRIP1L: c.3295-2A>G, and the CPLANE1: c.5820+3_5820+6del are predicted to disrupt normal splicing. Missense variants were more difficult to interpret, but those retained were prioritized based on rarity, in silico prediction, ACMG-based classification, and gene-disease relevanceThe functional effects of the identified variants at the RNA or protein level were not directly evaluated and therefore remain inferential, except for the CPLANE1: c.5820+3_5820+6del variant, which has previously been demonstrated to cause exon 29 skipping [7]. Protein change, variant class, classification, and allele frequencies for all reportable variants are provided in Tables 1 and 2.

DISCUSSION

Over the past decade, whole-exome sequencing (WES) has become an important tool in clinical genetics laboratories. With steadily decreasing costs, WES has been increasingly adopted as a first-tier approach in postnatal rare-disease diagnostics [19]. In addition, improvements in analytical pipelines have extended its potential utility to include CNV inference from exome data [20]. In prenatal genetics, WES has shown relatively high diagnostic yields in fetuses with ultrasound-detected anomalies, supporting its expanding role in prenatal evaluation [21].

In EPL, chromosomal abnormalities remain a major genetic contributor, but the potential role of monogenic causes in euploid POCs is still incompletely defined. Recent reports have started to describe single-gene findings in euploid fetal material; however, many studies include wide gestational ranges extending beyond the first trimester and apply heterogeneous sequencing and interpretation strategies, which may limit direct comparisons across cohorts and may complicate conclusions for losses occurring specifically before 12 gestational weeks [22,23]. Published data increasingly suggest that genes essential for early development and multiple organ systems may be represented among genetic findings in EPL cohorts [8,24].

In this study, we analyzed 66 euploid POCs from EPL occurring exclusively before 12 gestational weeks using WES and identified clinically relevant monogenic findings in a substantial subset of cases. A molecular diagnosis in the conceptus was established in 13/66 POCs (19.7%), and in an additional 9/66 POCs (13.6%) we identified findings that may represent a possible monogenic contribution, including compound heterozygosity with a pathogenic variant plus a VUS in autosomal recessive genes and VUS findings in autosomal dominant genes.

A key interpretive distinction in this study is between identifying a molecular diagnosis in the conceptus and establishing that the diagnosis plausibly explains the pregnancy loss. Not all pathogenic or likely pathogenic findings carry the same degree of etiologic relevance to EPL. This distinction is particularly important for genes associated with later-onset, variably expressive, incompletely penetrant, or susceptibility phenotypes. Accordingly, our interpretation framework emphasizes levels of causal confidence rather than treating all P/LP findings as equally explanatory for first-trimester loss.

Our molecular diagnostic yield of 19.7% is close to the 22% pathogenic/likely pathogenic abnormality-detection rate reported by Zhao et al. in the largest directly comparable exome study of chromosomally preselected products of conception [8]. However, comparisons across studies should be interpreted cautiously, because published cohorts differ substantially in specimen type, gestational window, prior exclusion of aneuploidy/CNVs, sequencing design, and the definition of a “positive” result. Several other reports used exploratory variant-prioritization or burden-based frameworks rather than ACMG-style diagnostic classification, and some included recurrent miscarriage or broader fetal/perinatal death cohorts rather than first-trimester euploid POCs. These methodological differences likely explain much of the variability in reported yields and reinforce the need to compare studies within the context of cohort design rather than by percentage alone [10, 11,24,36, 37, 38, 39]. A likely strength of the present study is the deliberate restriction to euploid losses before 12 gestational weeks, which reduces heterogeneity and allows a more focused assessment of monogenic findings in early miscarriage tissue. At the same time, our yield should be interpreted in light of our distinction between a molecular diagnosis in the conceptus and evidence that the finding explains EPL, as not all diagnosed conditions are equally likely to be directly causal for first-trimester loss.

To contextualize this heterogeneous gene set, we interpreted implicated genes within three biological categories: (1) genes plausibly associated with prenatal or early embryonic lethality, (2) genes causing severe congenital disorders not typically considered embryonically lethal, and (3) genes linked to later-onset or susceptibility phenotypes. This framework allows a more explicit separation of molecular diagnosis from etiologic inference.

Category 1: Genes plausibly associated with prenatal or early embryonic lethality

Molecular diagnosis in the conceptus (CPLANE1, DHCR7)

Among the autosomal recessive findings, CPLANE1 and DHCR7 represent some of the most plausible candidates for involvement in euploid EPL because biallelic pathogenic variants in these genes are associated with severe developmental disorders and have been discussed in the setting of fetal or perinatal lethality in other reports [25]. In our cohort, recurrent biallelic findings in unrelated families strengthen the biological plausibility of these genes as contributors to EPL.

For CPLANE1, associated with Joubert syndrome and related ciliopathy phenotypes, we observed biallelic variants in unrelated families, including a complex allele (c.1819delT;7817T>A) that appears enriched in our population and may warrant further investigation, particularly in families with recurrent EPL and Albanian ancestry [7]. While definitive causality in EPL cannot be inferred from sequencing alone, repeated observations of biallelic disruption in genes linked to severe developmental phenotypes support a role in early developmental non-viability.

Similarly, for DHCR7, we identified compound heterozygosity involving well-established pathogenic alleles associated with severe Smith-Lemli-Opitz syndrome (SLOS). Severe SLOS phenotypes have been reported with major developmental abnormalities, and both variants have been previously associated with pregnancy loss and/or severe pre-/neonatal phenotype [25].

Potential monogenic contribution (RPGRIP1L, PKHD1, GBA1)

Additional genes in this category include RPGRIP1L, PKHD1, GBA1 in which we identified compound heterozygosity involving a pathogenic variant and a VUS (AR genes). While these genes have been implicated in severe prenatal disorders, the specific variant combinations identified in our cohort lack sufficient evidence for definitive pathogenic classification [26, 27]. Therefore, these findings should be interpreted as possible contributors, pending functional validation and replication in independent cohorts.

Category 2: Genes causing severe congenital disorders not typically considered embryonically lethal

Molecular diagnosis in the conceptus (DSG2, DVL1, NF1, RBM8A, SLC6A1)

A second group comprised genes associated with severe developmental or multisystem disorders that are more often recognized postnatally than in the setting of very early pregnancy loss. This group included DSG2, DVL1, NF1, RBM8A, and SLC6A1. Detection of such findings establishes a molecular diagnosis in the conceptus but does not, by itself, prove etiologic attribution for EPL. Their contribution may range from biologically relevant to incidental or context-dependent, depending on the gene, variant type, penetrance, and the presence of additional fetal, placental, maternal, or environmental factors.

For DSG2 and other genes related to cardiac development or electrophysiology, a mechanistic connection to first-trimester loss remains indirect. Similarly, NF1 and SLC6A1 are well-established disease genes, but neither is classically regarded as a standard explanation for very early embryonic demise. We therefore interpret these findings as clinically meaningful molecular diagnoses with variable and often uncertain explanatory power for EPL. [28, 29, 30]

The RBM8A-associated TAR genotype identified in our cohort merits particularly careful interpretation. TAR syndrome results from compound inheritance of a null allele, typically the 1q21.1 deletion, in trans with a hypomorphic RBM8A regulatory allele such as c.-21G>A. Thus, c.-21G>A is not independently causative and becomes clinically relevant only in the presence of the deletion. In our cohort, this combined genotype supports a bona fide molecular diagnosis in the conceptus, although its precise contribution to early gestational loss remains to be clarified in larger datasets [31].

Possible monogenic contribution (MYH3, PAH, PRDM6, SCN5A, TBX18, TSC1)

The potential monogenic contribution subset in this category comprised genes with roles in cardiac development (PRDM6), fetal arrhythmia (SCN5A) or kidney anomalies (TBX18), skeletal development (MYH3), metabolic disease (PAH) and multisystem growth regulation (TSC1) [32,33]. Although there is biological plausibility for some of these findings, particularly those involving cardiac developmental pathways, the available evidence is insufficient for definitive pathogenic attribution in the present cohort. These variants are therefore interpreted conservatively as possible contributors rather than established causes of EPL.

Category 3: Genes linked to later-onset or susceptibility phenotypes

This group included findings in F5 and VWF, both of which were classified as P/LP at the molecular level but are more difficult to interpret as direct causes of first-trimester loss. These variants may reflect susceptibility, maternal-fetal interaction, placental factors, or other context-dependent mechanisms rather than classic monogenic embryonic lethality.

The identification of fetal homozygosity for Factor V Leiden in a case with maternal homozygosity is noteworthy, but it should be regarded as hypothesis-generating rather than directly explanatory for EPL. Likewise, the mechanistic link between a VWF finding and early embryonic demise remains uncertain. Accordingly, these results are best interpreted as clinically relevant findings of uncertain etiologic weight in relation to EPL [34].

More broadly, the diagnostic variants in our cohort spanned multiple disease categories, mirroring patterns reported in previous studies [35, 36, 37, 38, 39, 40, 41, 42]. The repeated recovery of similar functional categories across independent cohorts supports the view that disruption of core developmental pathways contributes to a subset of euploid EPL. At the same time, the presence of susceptibility or later-presenting diagnoses in early losses highlights that some findings may reflect allele-specific severity, variable expressivity, reduced penetrance, or coincident maternal and/or environmental factors rather than direct monogenic causation.

Recurrent biallelic findings in CPLANE1 and DHCR7 in unrelated families represent some of the strongest candidates for involvement in euploid EPL because they affect genes linked to severe developmental disorders and were observed more than once in the cohort as well as in other previously published studies [7, 25]. In contrast, the RBM8A case highlights the importance of integrated SNV/CNV interpretation, because the diagnosis depends on the combination of the regulatory c.-21G>A allele with the 1q21.1 deletion in trans. Finally, de novo findings such as SLC6A1 c.740C>A and the 21q22.12-q22.3 duplication clearly establish molecular diagnoses in the conceptus, but their direct explanatory value for first-trimester loss remains more uncertain and remains to be clarified.

Limitations and future directions

This study has several limitations. The cohort size is moderate and may not capture the full spectrum of rare variation contributing to EPL. Moreover, fetal-only WES, while practical in a diagnostic setting, limits the ability to identify all de novo variants, detect parental mosaicism, and confidently phase biallelic findings in every case; trio-based sequencing, when feasible, may improve interpretation [43]. In addition, detailed fetal phenotyping is inherently limited in first-trimester pregnancy-loss tissue, which restricts robust genotype–phenotype correlation.

Functional validation remains particularly important for novel variants and VUS, and future studies incorporating detailed family segregation data, transcriptomic, proteomic, model-system, and bioinformatic approaches will be needed to strengthen causal inference and further clarify the molecular effects of these variants [40, 41, 42, 43].

CONCLUSION

Whole-exome sequencing identified a molecular diagnosis in the conceptus in 19.7% (13/66) of euploid early pregnancy losses occurring before 12 gestational weeks. Our findings suggest that monogenic variants may contribute to a subset of euploid EPL cases, although the strength of evidence varies considerably across detected variants. The integration of WES into the evaluation of recurrent euploid pregnancy loss holds promise but should be interpreted with caution. Further studies incorporating functional analyses, larger cohorts, and parental data are needed to clarify causality and to define the clinical utility of such approaches in genetic counseling, recurrence-risk assessment, and reproductive planning.

ACKNOWLEDGMENTS

We thank all gynecologists and couples that contributed to the study.

Notes

[3] Ethics Committee Approval

The study was approved by the Ethics Subcommittee for Medicine, Pharmacy, Veterinary Medicine, and Dentistry of the Macedonian Academy of Sciences and Arts (03-203/2 from January 25, 2024). Written informed consent was obtained from all participants.

[4] Contributed by Author Contributions

Concept- Gj.B.; D.P.K; Design-D.P.K; Supervision-D.P.K; Materials-K.K.S.; Data Collection- Gj.B, P.N, M.T.; K.K.S.; Analysis or Interpretation- Gj.B, P.N., M.T.; D.P.K.; Literature Review- Gj.B, D.P.K.; Writing- Gj.B, D.P.K.; Critical Review- Gj.B, P.N., K.K.S., D.P.K.

[5] Conflicts of interest Conflict of Interest

The authors declared no conflict of interest.

[6] Financial disclosure Funding

Funded by Macedonian Academy of Sciences and Arts project: Molecular basis of spontaneous abortion, project number: 08-707 to DPK.

Notes

SUPPLEMENTARY TABLES

Supplemental Table S1.

Detailed overview of the demographic and clinical characteristics of the EPL studied group

Sample IDFetal sexEthnic originGestational age (weeks)Maternal AgeNo. of PLs (n)Livebirths (n)
1Abp-2FMKD84241
2Abp-26FALB73050
3Abp-76MMKD83130
4Abp-80FALB62660
5Abp-87MALB92941
6Abp-166FALB738120
7Abp-233FMKD84040
8Abp-251MMKD82940
9Abp-2581FMKD831110
10Abp-266FMKD73240
11Abp-2722MALB112840
12Abp-278FALB92442
13Abp-303FALB82920
14Abp-312MALB122731
15Abp-357MMKD94130
16Abp-367MALB83030
17Abp-3722MALB92960
18Abp-395MMKD92731
19Abp-404MALB72830
20Abp-407MALB83530
21Abp-411MALB83050
22Abp-4443FMKD92720
23Abp-4454FALB102420
24Abp-4575MALB92730
25Abp-488MALB83431
26Abp-494MMKD73230
27Abp-501FALB83170
28Abp-5176FALB82510
29Abp-5514FALB82530
30Abp-562MALB63230
31Abp-577FMKD84131
32Abp-5897FMKD83620
33Abp-5901MMKD835130
34Abp-591FMKD83540
35Abp-6013FMKD82830
36Abp-604MALB92940
37Abp-642FALB92530
38Abp-6565MALB72940
39Abp-6657MMKD73730
40Abp-666MMKD73340
41Abp-668MMKD103720
42Abp-677FMKD83140
43Abp-682FALB92620
44Abp-694MALB92320
45Abp-699MMKD122920
46Abp-715FALB82640
47Abp-716FMKD93120
48Abp-722MMKD63430
49Abp-729FMKD83620
50Abp-734MALB72431
51Abp-741MALB92230
52Abp-746MMKD83221
53Abp-781FMKD93320
54Abp-786FALB82720
55Abp-799MMKD83541
56Abp-801FMKD82521
57Abp-809MALB122030
58Abp-812FMKD63631
59Abp-8136MALB83030
60Abp-825FMKD73731
61Abp-833FMKD73920
62Abp-859MALB83123
63Abp-864MALB92430
64Abp-866FMKD84231
65Abp-900MMKD83720
66Abp-972FALB93141

1–7 fetuses from same family

Supplemental Table S2.

Designed PCR primer sequences used in the confirmation and segregation analyses.

GeneVariantPrimer namePrimer nucleotide sequence (5′>3′)PCR length (nt)
CPLANE1c.1819delTCPLANE1_c.1819_FCCACCAATGAGTCTTGAGCTG732
CPLANE1_c.1819_RAAGAACGCCAAAGTGATGCTAT
c.7817T>ACPLANE1_c.7817_FTGGGTTTGTAGGAGGAGAGGT471
CPLANE1_c.7817_RCATACTTCCTGCTCCTTTTCCT
c.5820+3_5820+6delCPLANE1_c.5820_FGCCACACAGCATGGCTATATT431
CPLANE1_c.5820_RTCTCAAGGCTCATCTGGGAT
DHCR7c.452G>ADHCR7_c.452_FGTGAAGCAAGTTCCATCCCC586
DHCR7_c.452_RGCAGAACCAAAGGATGGACTC
c.964-1G>CDHCR7_c.964-1_FGCAGAACACGCTCTTGACAG721
DHCR7_c.964-1_RCAGGTAGAAGGCAGGTAGAGTT
RBM8Ac.-21G>ARBM8A_ex1_FTGAAGGGGGCGGAATCTCTA353
RBM8A_ex1_RTGCGTGTTTTTACCGTGCAG
NF1c.4537C>TNF1_ex35_FTGGTCCTGAGGTCTTTTTGG560
NF1_ex35_RTGTTGTCTTCACTCCCTGGT
F5c.1601G>AFV-Leiden_FTGATGCCCAGTGCTTAACAA265
FV-Leiden_RTCACACTGGTGCTAAAAAGGA
TSC1c.3113_3119delTSC1_ex23_FGGCTCTCAGAAAGGCTACTGG436
TSC1_ex23_RCATCCTCCGAATGTGGACAG
VWFc.3797C>TVWF_ex28_FACCGGGATCACAATGACCTT632
VWF_ex28_RGTAGGGCTCAGAAGTGTCCA
SLC6A1c.740C>ASLC6A1_ex8_FAAATGTGAGCTGGTTGGCTC432
SLC6A1_ex8_RAAACCTGGTCTACAGTGAGGG
DSG2c.2315delDSG2_ex14_FGCCCACTTGACTCAGATCCT590
DSG2_ex14_RTGGGTCCCATTTCTCTTTCCTTA
DVL1c.1961dupDLV1_ex15_FGGTTGTTCTGGACGTGGC722
DLV1_ex15_RGGTCTTCCTCATCCCAGGAG
RPGRIP1Lc.2771G>ARPGRIP1L_2771G_A_FGGGGTGGCAGCTTAGTTCTT389
RPGRIP1L_2771G_A_RCCTGGCTAGTTCACATGGTAG
c.3295-2A>GRPGRIP1L_3295-2_FAGGCCAATGGGCTTCTTTTCT3211
RPGRIP1L_3295-2_RGATGGTGATGTCATCGGCTG
RPGRIP1L_3295-2_seqGCAGAGGTGGGCGGATCATGAG
PAHc.842C>TPAH_ex7_FGCCAGCAATGAACCCAAACC239
PAH_ex7_RTCTTTTCATCCCAGCTTGCAC
c.*19G>TPAH_ex13_FACAAGTGGCCCATTTTGATGGT402
PAH_ex13_RGGCCCATTTTGATGGTGTTTT
GBAc.1444G>TGBA_ex10_FCTGCCTCTCCCACATGTGA391
GBA_ex10_RCAAAAGGGGATGGGTGTGC
c.1226A>GGBA_EX9_FCTTTTCTGCATCGCAGTCCA459
GBA_EX9_RTCCCACATGTGACCCTTACC
PKHD1c.107C>TPKHD1_ex3_FCAGGCCCACTTTTACACCTG423
PKHD1_ex3_RGGGGCTTCTGATGATGTGTTT
c.10883C>TPKHD1_ex61_FATCAGCCCTCATTTGGATGTGA537
PKHD1_ex61_RTTCCATTCACTTGGCCCTCA
PRDM6c.1057G>APRDM6_ex5_FATTGGTTGCTGGGGACAATC380
PRDM6_ex5_RAGTGAACCACGTTTCATGAGT
TBX18c.1570C>TTBX18_ex8_FGCAACTGGATGAAACAGGGG1074
TBX18_ex8_RCTCCAACCCTTGCCTTGTAAC
SCN5Ac.3911C>TSCN5A_ex22_FCACGGCCATAGGACATCAGA268
SCN5A_ex22_RTGTTCCCATCCTCCCCATTT
MYH3c.3137G>AMYH3_ex25_FTCTTCTGAAACTGGAGGCCC345
MYH3_ex25_RCTTGCAAAGCATTTGTTCCCA
Supplemental Table S3.

PCR mixture and cycling conditions used for Sanger sequencing for confirmation and phasing of the detected variants on WES analysis.

PCR master mix content:Volume (ul)
H2O16.1
10xB2 buffer2.5
25mM MgCl21.3
2.5 mM nucleotide mix2
10mM Forward primer1
10 mM Reverse primer1
HotFire Polymerase 1U/ul0.1
DNA (100ng/ul)1
Total volume:25
PCR cycling conditions:
95°C/15 minx1 cycle
95°C/30 secx33 cycles
59°C/30 sec
72°C/45 sec
72°C/10 minx1 cycle
DOI: https://doi.org/10.2478/bjmg-2025-00028 | Journal eISSN: 2199-5761 (formerly 1311-0160) | Journal ISSN: 1311-0160
Language: English
Page range: 5 - 20
Published on: May 14, 2026
Published by: Macedonian Academy of Sciences and Arts
In partnership with: Paradigm Publishing Services

© 2026 Gj Bozhinovski, P Noveski, M Terzikj, K Kubelka-Sabit, D Plaseska-Karanfilska, published by Macedonian Academy of Sciences and Arts
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.