Table 1
miRNAs used in the study and their properties.
| miRNA ID | Accession Number; Sequence | Expression | Function | Refs. |
|---|---|---|---|---|
| Hsa-miR-375-3p | MIMAT0000728; UUUGUUCGUUCGGCUCGCGUGA | downregulation | apoptosis | [10,11,12] |
| Hsa-miR-148a-3p | MIMAT0000243; AAAGUUCUGAGACACUCCGACU | downregulation | DX; metastasis; invasion; poor prognosis | [13] |
| Hsa-miR-196a-5p | MIMAT0000226; AAAGUUCUGAGACACUCCGACU | upregulation | poor prognosis; DX | [14,15] |
| Hsa-miR-376c-3p | MIMAT0000720; AACAUAGAGGAAAUUCCACGU | downregulation; upregulation | apoptosis; cell proliferation | 16,17] |
| Hsa-miR-129-5p | MIMAT0000242; CUUUUUGCGGUCUGGGCUUGC | downregulation | poor prognosis | [18,19] |
| Hsa-miR-34c-5p | MIMAT0000686; AGGCAGUGUAGUUAGCUGAUUGC | downregulation | apoptosis; cell-cycle | [20] |
| Hsa-miR-662 | MIMAT0003325; UCCCACGUUGUGGCCCAGCAG | downregulation | unknown | [21] |
| Hsa-miR-767-5p | MIMAT0003882; UGCACCAUGGUUGUCUGAGCAUG | downregulation | cell proliferation; migration and invasion | [22] |
[i] ID: identity; Refs.: references.
Table 2
Evaluation of the demographic, clinical and pathological features of the 20 patients.
| Variables | n; mean ± SD; % |
|---|---|
| Age (years): | 64.9±13.8 |
| <60 years old | 7; 50.00±8.75; 35.0% |
| >60 years old | 13; 72.92±8.01; 65.0% |
| Gender: | |
| females | 3; 15.0% |
| males | 17; 85.0% |
| Helicobacater pylori | 3; 15.0% |
| Smoking | 9; 45.0% |
| PPI/H2RB | 5; 20.0% |
| Family history | 1; 5.0% |
| Blood group: | |
| A Rh (+) | 8; 40.0% |
| O Rh (+) | 5; 25.0% |
| B Rh (+) | 4; 20.0% |
| A Rh (−) | 1; 5.0% |
| O Rh (−) | 1; 5.0% |
| AB Rh (+) | 1; 5.0% |
| Preoperative: | |
| CEA (ng/mL) | 12.94±21.75; normal: 0–5 |
| CA19-9 (U/mL) | 122.64±217.83; normal: 0–27 |
| AFP (ng/mL) | 2.84±1.60; normal: 0–7 |
| Tumor location | |
| cardiac | 10; 50.0% |
| non cardiac | 10; 50.0% |
| Differentiation: | |
| poorly differentiated | 7; 35.0% |
| mid differentiated | 11; 55.0% |
| well differentiated | 2; 10.0% |
| Borman classification: | |
| type 1 | 9; 45.0% |
| type 2 | 4; 20.0% |
| type 3 | 7; 35.0% |
| pT: | |
| pT1 | 1; 5.0% |
| pT2 | 0; 0.0% |
| pT3 | 13; 65.0% |
| pT4 | 6; 30.0% |
| pN: | |
| pN0 | 3; 15.0% |
| pN1 | 4; 20.0% |
| pN2 | 7; 35.0% |
| pN3 | 6; 30.0% |
| Lymphpvascular invasion | 18; 90.0% |
| Nerve invasion | 14; 60.0% |
| Stage: | |
| I | 1; 5.0% |
| II | 5; 25.0% |
| III | 14; 60.0% |
[i] PPI/H2RB: proton pump inhibitor/histamine 2 receptor blocker; CEA: carcinoembryonic antigen; CA19-9: carbohydrate antigen 19-9; AFP: α-fetoprotein; pT: pathological t stage; pN: pathological n stage.
Table 3
Exchange of miRNA expressions of cancerous and normal tissues of patients (2−ΔΔCt).
| Patient Code | Hsa-miR-375-3p | Hsa-miR-148a-3p | Hsa-miR-196a-5p | Hsa-miR-376c-3p | Hsa-miR-129-5p | Hsa-miR-34c-5p | Hsa-miR-662 | Hsa-miR-767-5p |
|---|---|---|---|---|---|---|---|---|
| GCM-01 | 3.158 | −5.382 | 0.803 | −0.238 | 2.043 | 1.498 | 0.598 | 2.113 |
| GCM-02 | −1.958 | 1.573 | −0.613 | −1.103 | −0.228 | −1.213 | −0.803 | −3.278 |
| GCM-03 | 2.198 | −1.248 | 1.348 | 0.631 | 1.173 | 0.723 | 1.083 | 1.008 |
| GCM-04 | 4.570 | −2.495 | 0.810 | 5.725 | 1.670 | 3.340 | 2.680 | 3.000 |
| GCM-05 | 1.618 | 4.908 | 2.158 | 0.843 | 1.573 | 3.158 | −0.858 | 0.753 |
| GCM-06 | −2.393 | −0.268 | −0.758 | −2.853 | −3.058 | −3.078 | 4.128 | −4.633 |
| GCM-07 | −8.520 | 4.720 | −0.095 | −5.420 | −0.610 | −1.855 | −1.255 | −4.633 |
| GCM-08a | −2.368 | −2.553 | −0.653 | 0.038 | −0.498 | 0.618 | −0.723 | −1.958 |
| GCM-09 | −4.745 | −0.085 | −1.400 | −4.415 | −2.638 | −1.905 | −3.125 | −5.945 |
| GCM-10 | −7.380 | −3.240 | −2.575 | −4.335 | −3.155 | −5.810 | −4.650 | −6.015 |
| GCM-11 | −0.608 | NA | −1.318 | −1.763 | 0.852 | −1.723 | −2.243 | −1.998 |
| GCM-12 | −4.353 | NA | −3.178 | −0.978 | −2.053 | −3.633 | −3.653 | −3.563 |
| GCM-13 | −3.673 | −4.003 | −3.613 | −6.353 | −4.053 | −5.793 | −4.688 | −6.993 |
| GCM-14 | 0.503 | −1.293 | −1.053 | −1.048 | −0.558 | −0.608 | 0.543 | 0.688 |
| GCM-15 | 0.788 | −1.008 | −1.208 | −3.843 | −0.533 | −0.678 | −0.203 | −0.143 |
| GCM-16 | −0.3055 | 0.520 | −3.315 | −3.445 | −2.595 | −3.085 | −0.225 | −3.815 |
| GCM-17 | −2.360 | −1.330 | −3.095 | −3.885 | −2.750 | −3.020 | −2.560 | −2.260 |
| GCM-18 | −3.005 | −2.175 | −1.395 | −0.920 | −1.040 | −0.985 | 0.025 | −2.495 |
| GCM-19a | −2.168 | 3.388 | −3.003 | −1.228 | −0.473 | −2.388 | −1.403 | −3.838 |
| GCM-20 | −5.110 | −2.210 | −3.840 | −3.250 | −0.930 | −3.205 | −1.125 | −2.310 |
Table 4
Statistical comparisons between cancerous and normal tissues in patients with gastric cancer.
| miRNA ID | Average Change | 95% CI | p Value |
|---|---|---|---|
| Hsa-miR-375-3p | −1.943 | −3.521/−0.365 | 0.018a |
| Hsa-miR-148a-3p | −0.676 | −2.085/0.731 | 0.324 |
| Hsa-miR-196a-5p | −1.299 | −2.115/−0.483 | 0.003b |
| Hsa-miR-376c-3p | −1.891 | −3.160/−0.623 | 0.006b |
| Hsa-miR-129-5p | −0.892 | −1.726/−0.059 | 0.037a |
| Hsa-miR-34c-5p | −1.482 | −2.650/−0.314 | 0.016a |
| Hsa-miR-662 | −0.922 | −1.964/0.118 | 0.079 |
| Hsa-miR-767-5p | −2.387 | −3.735/−1.040 | 0.001b |

Figure 1
Expression changes of miRNAs in cancerous tissues.

Figure 2
Relative expression changes of miRNAs in cancerous and normal tissues (*p <0,05, **p <0,01).
Table 5
Comparison of patient age, metastatic lymph node number and smoking with miRNA expressions.
| miRNA ID | Age; r Value | Age; p Value | Metastatic Lymph Node; r Value | Metastatic Lymph Node; p Value | Smoking p Value |
|---|---|---|---|---|---|
| Hsa-miR-375-3p | −0.160 | 0.512 | 0.350 | 0.135 | 0.102 |
| Hsa-miR-148a-3p | −0.320 | 0.196 | 0.290 | 0.240 | 0.245 |
| Hsa-miR-196a-5p | −0.330 | 0.159 | 0.430 | 0.056 | 0.412 |
| Hsa-miR-376c-3p | −0.420 | 0.063 | 0.410 | 0.075 | 0.043a |
| Hsa-miR-129-5p | −0.320 | 0.173 | 0.470 | 0.036a | 0.150 |
| Hsa-miR-34c-5p | −0.380 | 0.102 | 0.510 | 0.020a | 0.274 |
| Hsa-miR-662 | −0.440 | 0.049a | 0.210 | 0.370 | 0.195 |
| Hsa-miR-767-5p | −0.330 | 0.156 | 0.400 | 0.077 | 0.344 |

Figure 3
Hierarchical clustering and heatmap of miRNAs. Hierarchical cluster using “Euclidean” distance and “complete” linkage. (L.N.: Lymph node).