Targeted microRNA Profiling in Gastric Cancer with Clinical Assessement

Pehlevan Özel, H; Dinç, T; Tiryaki, RS; Keşküş, AG; Konu, Ö; Kayilioğlu, SI; Coşkun, F

Targeted microRNA Profiling in Gastric Cancer with Clinical Assessement

Balkan Journal of Medical Genetics

Volume 24 (2021): Issue 2 (November 2021)

By:

H Pehlevan Özel, T Dinç, RS Tiryaki, AG Keşküş, Ö Konu, SI Kayilioğlu and F Coşkun

Open Access

|Jun 2022

Figures & Tables

Expression changes of miRNAs in cancerous tissues.

Relative expression changes of miRNAs in cancerous and normal tissues (*p <0,05, **p <0,01).

Hierarchical clustering and heatmap of miRNAs. Hierarchical cluster using “Euclidean” distance and “complete” linkage. (L.N.: Lymph node).

Comparison of patient age, metastatic lymph node number and smoking with miRNA expressions_

miRNA ID	Age; r Value	Age; p Value	Metastatic Lymph Node; r Value	Metastatic Lymph Node; p Value	Smoking p Value
Hsa-miR-375-3p	−0.160	0.512	0.350	0.135	0.102
Hsa-miR-148a-3p	−0.320	0.196	0.290	0.240	0.245
Hsa-miR-196a-5p	−0.330	0.159	0.430	0.056	0.412
Hsa-miR-376c-3p	−0.420	0.063	0.410	0.075	0.043^a
Hsa-miR-129-5p	−0.320	0.173	0.470	0.036^a	0.150
Hsa-miR-34c-5p	−0.380	0.102	0.510	0.020^a	0.274
Hsa-miR-662	−0.440	0.049^a	0.210	0.370	0.195
Hsa-miR-767-5p	−0.330	0.156	0.400	0.077	0.344

Statistical comparisons between cancerous and normal tissues in patients with gastric cancer_

miRNA ID	Average Change	95% CI	p Value
Hsa-miR-375-3p	−1.943	−3.521/−0.365	0.018^a
Hsa-miR-148a-3p	−0.676	−2.085/0.731	0.324
Hsa-miR-196a-5p	−1.299	−2.115/−0.483	0.003^b
Hsa-miR-376c-3p	−1.891	−3.160/−0.623	0.006^b
Hsa-miR-129-5p	−0.892	−1.726/−0.059	0.037^a
Hsa-miR-34c-5p	−1.482	−2.650/−0.314	0.016^a
Hsa-miR-662	−0.922	−1.964/0.118	0.079
Hsa-miR-767-5p	−2.387	−3.735/−1.040	0.001^b

Exchange of miRNA expressions of cancerous and normal tissues of patients (2−ΔΔCt)_

Patient Code	Hsa-miR-375-3p	Hsa-miR-148a-3p	Hsa-miR-196a-5p	Hsa-miR-376c-3p	Hsa-miR-129-5p	Hsa-miR-34c-5p	Hsa-miR-662	Hsa-miR-767-5p
GCM-01	3.158	−5.382	0.803	−0.238	2.043	1.498	0.598	2.113
GCM-02	−1.958	1.573	−0.613	−1.103	−0.228	−1.213	−0.803	−3.278
GCM-03	2.198	−1.248	1.348	0.631	1.173	0.723	1.083	1.008
GCM-04	4.570	−2.495	0.810	5.725	1.670	3.340	2.680	3.000
GCM-05	1.618	4.908	2.158	0.843	1.573	3.158	−0.858	0.753
GCM-06	−2.393	−0.268	−0.758	−2.853	−3.058	−3.078	4.128	−4.633
GCM-07	−8.520	4.720	−0.095	−5.420	−0.610	−1.855	−1.255	−4.633
GCM-08^a	−2.368	−2.553	−0.653	0.038	−0.498	0.618	−0.723	−1.958
GCM-09	−4.745	−0.085	−1.400	−4.415	−2.638	−1.905	−3.125	−5.945
GCM-10	−7.380	−3.240	−2.575	−4.335	−3.155	−5.810	−4.650	−6.015
GCM-11	−0.608	NA	−1.318	−1.763	0.852	−1.723	−2.243	−1.998
GCM-12	−4.353	NA	−3.178	−0.978	−2.053	−3.633	−3.653	−3.563
GCM-13	−3.673	−4.003	−3.613	−6.353	−4.053	−5.793	−4.688	−6.993
GCM-14	0.503	−1.293	−1.053	−1.048	−0.558	−0.608	0.543	0.688
GCM-15	0.788	−1.008	−1.208	−3.843	−0.533	−0.678	−0.203	−0.143
GCM-16	−0.3055	0.520	−3.315	−3.445	−2.595	−3.085	−0.225	−3.815
GCM-17	−2.360	−1.330	−3.095	−3.885	−2.750	−3.020	−2.560	−2.260
GCM-18	−3.005	−2.175	−1.395	−0.920	−1.040	−0.985	0.025	−2.495
GCM-19^a	−2.168	3.388	−3.003	−1.228	−0.473	−2.388	−1.403	−3.838
GCM-20	−5.110	−2.210	−3.840	−3.250	−0.930	−3.205	−1.125	−2.310

Evaluation of the demographic, clinical and pathological features of the 20 patients_

Variables	n; mean ± SD; %

Age (years):	64.9±13.8
<60 years old	7; 50.00±8.75; 35.0%
>60 years old	13; 72.92±8.01; 65.0%

Gender:
females	3; 15.0%
males	17; 85.0%

Helicobacater pylori	3; 15.0%

Smoking	9; 45.0%

PPI/H2RB	5; 20.0%

Family history	1; 5.0%

Blood group:
A Rh (+)	8; 40.0%
O Rh (+)	5; 25.0%
B Rh (+)	4; 20.0%
A Rh (−)	1; 5.0%
O Rh (−)	1; 5.0%
AB Rh (+)	1; 5.0%

Preoperative:
CEA (ng/mL)	12.94±21.75; normal: 0–5
CA19-9 (U/mL)	122.64±217.83; normal: 0–27
AFP (ng/mL)	2.84±1.60; normal: 0–7

Tumor location
cardiac	10; 50.0%
non cardiac	10; 50.0%

Differentiation:
poorly differentiated	7; 35.0%
mid differentiated	11; 55.0%
well differentiated	2; 10.0%

Borman classification:
type 1	9; 45.0%
type 2	4; 20.0%
type 3	7; 35.0%

pT:
pT1	1; 5.0%
pT2	0; 0.0%
pT3	13; 65.0%
pT4	6; 30.0%

pN:
pN0	3; 15.0%
pN1	4; 20.0%
pN2	7; 35.0%
pN3	6; 30.0%

Lymphpvascular invasion	18; 90.0%

Nerve invasion	14; 60.0%

Stage:
I	1; 5.0%
II	5; 25.0%
III	14; 60.0%

miRNAs used in the study and their properties_

miRNA ID	Accession Number; Sequence	Expression	Function	Refs.
Hsa-miR-375-3p	MIMAT0000728;UUUGUUCGUUCGGCUCGCGUGA	downregulation	apoptosis	[10,11,12]
Hsa-miR-148a-3p	MIMAT0000243;AAAGUUCUGAGACACUCCGACU	downregulation	D_X; metastasis; invasion; poor prognosis	[13]
Hsa-miR-196a-5p	MIMAT0000226;AAAGUUCUGAGACACUCCGACU	upregulation	poor prognosis; D_X	[14,15]
Hsa-miR-376c-3p	MIMAT0000720;AACAUAGAGGAAAUUCCACGU	downregulation; upregulation	apoptosis; cell proliferation	16,17]
Hsa-miR-129-5p	MIMAT0000242;CUUUUUGCGGUCUGGGCUUGC	downregulation	poor prognosis	[18,19]
Hsa-miR-34c-5p	MIMAT0000686;AGGCAGUGUAGUUAGCUGAUUGC	downregulation	apoptosis; cell-cycle	[20]
Hsa-miR-662	MIMAT0003325;UCCCACGUUGUGGCCCAGCAG	downregulation	unknown	[21]
Hsa-miR-767-5p	MIMAT0003882;UGCACCAUGGUUGUCUGAGCAUG	downregulation	cell proliferation; migration and invasion	[22]

DOI: https://doi.org/10.2478/bjmg-2021-0022 | Journal eISSN: 2199-5761

Journal RSS Feed

Language: English

Page range: 55 - 64

Published on: Jun 5, 2022

Published by: Macedonian Academy of Sciences and Arts

In partnership with: Paradigm Publishing Services

Publication frequency: 2 issues per year

Keywords:

Gastric adenocarcinoma tissues,

Gastric cancer,

Gastric cancer patients,

Metastatic lymph nodes,

microRNAs (miRNAs)

Related subjects:

Medicine,

Basic medical science,

Basic medical science, other

© 2022 H Pehlevan Özel, T Dinç, RS Tiryaki, AG Keşküş, Ö Konu, SI Kayilioğlu, F Coşkun, published by Macedonian Academy of Sciences and Arts
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous article Volume 24 (2021): Issue 2 (November 2021)Next article

Targeted microRNA Profiling in Gastric Cancer with Clinical Assessement

Figures & Tables

Figure 1

Figure 2

Figure 3

Comparison of patient age, metastatic lymph node number and smoking with miRNA expressions_

Statistical comparisons between cancerous and normal tissues in patients with gastric cancer_

Exchange of miRNA expressions of cancerous and normal tissues of patients (2−ΔΔCt)_

Evaluation of the demographic, clinical and pathological features of the 20 patients_

miRNAs used in the study and their properties_

Paradigm

My account