Frequency of antibiotics resistance pattern in intI1-positive and -negative among P_ aeruginosa isolates
| Antibiotic | intI1- positive | intI1- negative | P-value | |
|---|---|---|---|---|
| Piperacillin/tazobactam | Resistant | 34 (94.4) | 31 (91.2) | 0.59 |
| Susceptible | 2 (5.6) | 3 (8.8) | ||
| Ceftazidime | Resistant | 29 (80.6) | 32 (94.1) | 0.09 |
| Susceptible | 7 (19.4) | 2 (5.9) | ||
| Imipenem | Resistant | 35 (97.2) | 31 (91.2) | 0.27 |
| Susceptible | 1 (2.8) | 3 (8.8) | ||
| Ciprofloxacin | Resistant | 30 (83.3) | 27 (79.4) | 0.67 |
| Susceptible | 6 (16.7) | 7 (20.6) | ||
| Gentamicin | Resistant | 35 (97.2) | 33 (97) | 0.96 |
| Susceptible | 1 (2.8) | 1 (3) | ||
Primers used in the study
| Gene type | Primer/Sequence (5′ 3′) | Product Size (bp) | References |
|---|---|---|---|
| IntI1 | F:GGTCAAGGATCTGGATTTCG | 483 | [38] |
| R:ACATGCGTGTAAATCATCGTC | |||
| IntI2 | F:CACGGATATGCGACAAAAAGGT | 789 | [38] |
| R:GTAGCAAACGAGTGACGAAATG | |||
| IntI3 | F:AGTGGGTGGCGAATGAGTG | 580 | [38] |
| R:TGTTCTTGTATCGGCAGGTG |
Frequency of antibiotic resistance pattern in intI2-positive and negative among P_ aeruginosa isolates
| Antibiotics | intI2 - positive | intI2 - negative | P-value | |
|---|---|---|---|---|
| Piperacillin/tazobactam | Resistant | 19 (90.5) | 46(93.9) | 0.61 |
| Susceptible | 2 (9.5) | 3 (6.1) | ||
| Ceftazidime | Resistant | 20 (95.2) | 41 (83.7) | 0.18 |
| Susceptible | 1 (4.8) | 8 (16.3) | ||
| Imipenem | Resistant | 19 (90.5) | 47 (95.9) | 0.36 |
| Susceptible | 2 (9.5) | 2 (4.1) | ||
| Ciprofloxacin | Resistant | 15 (71.4) | 42 (85.7) | 0.15 |
| Susceptible | 6 (28.6) | 7 (14.3) | ||
| Gentamicin | Resistant | 20 (95.2) | 47 (95.9) | 0.89 |
| Susceptible | 1 (4.8) | 2 (4.1) | ||