Skip to main content
Have a personal or library account? Click to login
Investigation of antimicrobial susceptibility, class I, II, and III integrons among clinical isolates of Pseudomonas aeruginosa from hospitalized burn patients in Southern Iran Cover

Investigation of antimicrobial susceptibility, class I, II, and III integrons among clinical isolates of Pseudomonas aeruginosa from hospitalized burn patients in Southern Iran

Open Access
|Mar 2024

Figures & Tables

Frequency of antibiotics resistance pattern in intI1-positive and -negative among P_ aeruginosa isolates

AntibioticintI1- positive n = 36 No. (%)intI1- negative n = 34 No. (%)P-value
Piperacillin/tazobactamResistant34 (94.4)31 (91.2)0.59
Susceptible2 (5.6)3 (8.8)
CeftazidimeResistant29 (80.6)32 (94.1)0.09
Susceptible7 (19.4)2 (5.9)
ImipenemResistant35 (97.2)31 (91.2)0.27
Susceptible1 (2.8)3 (8.8)
CiprofloxacinResistant30 (83.3)27 (79.4)0.67
Susceptible6 (16.7)7 (20.6)
GentamicinResistant35 (97.2)33 (97)0.96
Susceptible1 (2.8)1 (3)

Primers used in the study

Gene typePrimer/Sequence (5′ 3′)Product Size (bp)References
IntI1F:GGTCAAGGATCTGGATTTCG483[38]
R:ACATGCGTGTAAATCATCGTC
IntI2F:CACGGATATGCGACAAAAAGGT789[38]
R:GTAGCAAACGAGTGACGAAATG
IntI3F:AGTGGGTGGCGAATGAGTG580[38]
R:TGTTCTTGTATCGGCAGGTG

Frequency of antibiotic resistance pattern in intI2-positive and negative among P_ aeruginosa isolates

AntibioticsintI2 - positive n = 21 No. (%)intI2 - negative n = 49 No. (%)P-value
Piperacillin/tazobactamResistant19 (90.5)46(93.9)0.61
Susceptible2 (9.5)3 (6.1)
CeftazidimeResistant20 (95.2)41 (83.7)0.18
Susceptible1 (4.8)8 (16.3)
ImipenemResistant19 (90.5)47 (95.9)0.36
Susceptible2 (9.5)2 (4.1)
CiprofloxacinResistant15 (71.4)42 (85.7)0.15
Susceptible6 (28.6)7 (14.3)
GentamicinResistant20 (95.2)47 (95.9)0.89
Susceptible1 (4.8)2 (4.1)
Language: English
Page range: 170 - 175
Submitted on: Apr 10, 2022
Accepted on: Mar 31, 2023
Published on: Mar 14, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2024 Rezvan Mirzaei, Fereshte Ghandehari, Nazanin Delroshan, Laleh Hoveida, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.