Skip to main content
Have a personal or library account? Click to login
Quantitative evaluation of the genus Bifidobacterium in stool samples of patients with type 1 and 2 diabetes Cover

Quantitative evaluation of the genus Bifidobacterium in stool samples of patients with type 1 and 2 diabetes

Open Access
|Jul 2023

Figures & Tables

Figure 1.

Risk factors for T1DM and T2DM

Table 1.

Sequences of primers, reaction mixture and amplification program used in the study

Bifidobacterium spp.All bacteria
Oligonucleotide sequence (5′−> 3′)F: CTCCTGGAAACGGGTGG
R:GGTGTTCTTCCCGATATCTACA
F: CCTACGGGNGGCWGCAG
R:GACTACHVGGGTATCTAATCC
Reaction mixtureWater2.8 µl
SYBR Green PCR Master Mix5 µl
Primer F (20mM)0.1 µl
Primer R (20mM)0.1 µl
DNA2 µl
Amplification program95°C – 5 min95°C – 5 min
95°C – 30 sec40 cycles95°C – 30 sec40 cycles
53°C – 30 sec55°C – 30 sec
72°C – 30 sec72°C – 30 sec
Table 2.

Characteristics of the studied patient groups

T1DM
n = 33
T2DM
n = 31
CONTROL
n = 33
p-value
Sex: male: female (n)9 : 2413 : 1810 : 230.424
Age (yrs)39.36 (± 13.27)62.68 (± 8.87)41.21 (± 13.96)<0.001
BMI [kg/m2]24.27 (± 4.80)29.28 (± 4.95)23.62 (± 1.74)<0.001
Glucose [mmol/l]7.26 (± 1.63)7.85 (± 2.62)4.67 (± 0.56)<0.001*
Total cholesterol [mmol/l]4.66 (± 0.89)4.71 (± 1.19)5.17 (± 0.70)0.025
HDL [mmol/l]1.68 (± 0.40)1.12 (± 0.37)1.65 (± 0.33)<0.001
LDL [mmol/l]2.60 (± 0.75)2.70 (± 1.06)3.09 (± 0.54)0.009
Triglycerides (TG) [mmol/l]0.99 (± 0.57)2.29 (± 1.83)0.98 (± 0.43)<0.001*
ALT [U/l]17.73 (± 8.57)28.58 (± 16.46)18.92 (± 6.36)<0.001*
HbA1c [%]8.37 (± 2.72)8.11 (± 2.72)5.38 (± 0.24)<0.001
Bifidobacterium spp.
[CFU/g]
[logCFU/g]
7.08 × 106 (± 2.14 × 107)
6.13 (± 0.95)
6.38 × 106 (± 9.59 × 106)
6.34 (± 0.77)
1.41 × 107 (± 1.76 × 107)
6.93 ± (0.43)
<0.001*
All bacteria
[CFU/g]
[logCFU/g]
7.27 × 1011 (± 9.04 × 1011)
11.32 (± 0.96)
7.29 × 1011 (± 7.57 × 1011)
11.49 (± 0.73)
1.48 × 1012 (± 4.09 × 1012)
11.58 (± 0.59)
0.397
Language: English
Page range: 59 - 64
Submitted on: May 11, 2022
Accepted on: Mar 11, 2023
Published on: Jul 4, 2023
Published by: Hirszfeld Institute of Immunology and Experimental Therapy
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2023 Agnieszka Krawczyk, Katarzyna Talaga-Ćwiertnia, Katarzyna Biegun, Kamil Drożdż, Dominika Salamon, Tomasz Gosiewski, Agnieszka Sroka-Oleksiak, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.