Have a personal or library account? Click to login
Quantitative evaluation of the genus Bifidobacterium in stool samples of patients with type 1 and 2 diabetes Cover

Quantitative evaluation of the genus Bifidobacterium in stool samples of patients with type 1 and 2 diabetes

Open Access
|Jul 2023

Figures & Tables

Figure 1.

Risk factors for T1DM and T2DM
Risk factors for T1DM and T2DM

Sequences of primers, reaction mixture and amplification program used in the study

Bifidobacterium spp.All bacteria

Oligonucleotide sequence (5′−> 3′)F: CTCCTGGAAACGGGTGGR:GGTGTTCTTCCCGATATCTACAF: CCTACGGGNGGCWGCAGR:GACTACHVGGGTATCTAATCC

Reaction mixture Water2.8 µl
SYBR Green PCR Master Mix5 µl
Primer F (20mM)0.1 µl
Primer R (20mM)0.1 µl
DNA2 µl

Amplification program95°C – 5 min 95°C – 5 min
95°C – 30 sec40 cycles95°C – 30 sec40 cycles
53°C – 30 sec55°C – 30 sec
72°C – 30 sec72°C – 30 sec

Characteristics of the studied patient groups

T1DMn = 33T2DMn = 31CONTROLn = 33p-value
Sex: male: female (n)9 : 2413 : 1810 : 230.424
Age (yrs)39.36 (± 13.27)62.68 (± 8.87)41.21 (± 13.96)<0.001
BMI [kg/m2]24.27 (± 4.80)29.28 (± 4.95)23.62 (± 1.74)<0.001
Glucose [mmol/l]7.26 (± 1.63)7.85 (± 2.62)4.67 (± 0.56)<0.001*
Total cholesterol [mmol/l]4.66 (± 0.89)4.71 (± 1.19)5.17 (± 0.70)0.025
HDL [mmol/l]1.68 (± 0.40)1.12 (± 0.37)1.65 (± 0.33)<0.001
LDL [mmol/l]2.60 (± 0.75)2.70 (± 1.06)3.09 (± 0.54)0.009
Triglycerides (TG) [mmol/l]0.99 (± 0.57)2.29 (± 1.83)0.98 (± 0.43)<0.001*
ALT [U/l]17.73 (± 8.57)28.58 (± 16.46)18.92 (± 6.36)<0.001*
HbA1c [%]8.37 (± 2.72)8.11 (± 2.72)5.38 (± 0.24)<0.001
Bifidobacterium spp.[CFU/g][logCFU/g]7.08 × 106 (± 2.14 × 107)6.13 (± 0.95)6.38 × 106 (± 9.59 × 106)6.34 (± 0.77)1.41 × 107 (± 1.76 × 107)6.93 ± (0.43)<0.001*
All bacteria[CFU/g][logCFU/g]7.27 × 1011 (± 9.04 × 1011)11.32 (± 0.96)7.29 × 1011 (± 7.57 × 1011)11.49 (± 0.73)1.48 × 1012 (± 4.09 × 1012)11.58 (± 0.59)0.397
Language: English
Page range: 59 - 64
Submitted on: May 11, 2022
|
Accepted on: Mar 11, 2023
|
Published on: Jul 4, 2023
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2023 Agnieszka Krawczyk, Katarzyna Talaga-Ćwiertnia, Katarzyna Biegun, Kamil Drożdż, Dominika Salamon, Tomasz Gosiewski, Agnieszka Sroka-Oleksiak, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.