Quantitative evaluation of the genus Bifidobacterium in stool samples of patients with type 1 and 2 diabetes

	Bifidobacterium spp.		All bacteria

Oligonucleotide sequence (5′−> 3′)	F: CTCCTGGAAACGGGTGGR:GGTGTTCTTCCCGATATCTACA		F: CCTACGGGNGGCWGCAGR:GACTACHVGGGTATCTAATCC

Reaction mixture		Water	2.8 µl
		SYBR Green PCR Master Mix	5 µl
		Primer F (20mM)	0.1 µl
		Primer R (20mM)	0.1 µl
		DNA	2 µl

Amplification program	95°C – 5 min		95°C – 5 min
	95°C – 30 sec	40 cycles	95°C – 30 sec	40 cycles
	53°C – 30 sec		55°C – 30 sec
	72°C – 30 sec		72°C – 30 sec

Characteristics of the studied patient groups

	T1DMn = 33	T2DMn = 31	CONTROLn = 33	p-value
Sex: male: female (n)	9 : 24	13 : 18	10 : 23	0.424
Age (yrs)	39.36 (± 13.27)	62.68 (± 8.87)	41.21 (± 13.96)	<0.001
BMI [kg/m²]	24.27 (± 4.80)	29.28 (± 4.95)	23.62 (± 1.74)	<0.001
Glucose [mmol/l]	7.26 (± 1.63)	7.85 (± 2.62)	4.67 (± 0.56)	<0.001*
Total cholesterol [mmol/l]	4.66 (± 0.89)	4.71 (± 1.19)	5.17 (± 0.70)	0.025
HDL [mmol/l]	1.68 (± 0.40)	1.12 (± 0.37)	1.65 (± 0.33)	<0.001
LDL [mmol/l]	2.60 (± 0.75)	2.70 (± 1.06)	3.09 (± 0.54)	0.009
Triglycerides (TG) [mmol/l]	0.99 (± 0.57)	2.29 (± 1.83)	0.98 (± 0.43)	<0.001*
ALT [U/l]	17.73 (± 8.57)	28.58 (± 16.46)	18.92 (± 6.36)	<0.001*
HbA1c [%]	8.37 (± 2.72)	8.11 (± 2.72)	5.38 (± 0.24)	<0.001
Bifidobacterium spp.[CFU/g][logCFU/g]	7.08 × 10⁶ (± 2.14 × 10⁷)6.13 (± 0.95)	6.38 × 10⁶ (± 9.59 × 10⁶)6.34 (± 0.77)	1.41 × 10⁷ (± 1.76 × 10⁷)6.93 ± (0.43)	<0.001*
All bacteria[CFU/g][logCFU/g]	7.27 × 10¹¹ (± 9.04 × 10¹¹)11.32 (± 0.96)	7.29 × 10¹¹ (± 7.57 × 10¹¹)11.49 (± 0.73)	1.48 × 10¹² (± 4.09 × 10¹²)11.58 (± 0.59)	0.397

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/ahem-2023-0007 | Journal eISSN: 1732-2693

Journal RSS Feed

Language: English

Page range: 59 - 64

Submitted on: May 11, 2022

Accepted on: Mar 11, 2023

Published on: Jul 4, 2023

Published by: Hirszfeld Institute of Immunology and Experimental Therapy

In partnership with: Paradigm Publishing Services

Publication frequency: 1 issue per year

Keywords:

bifidobacteria,

biochemical parameters,

diabetes,

intestinal microbiota,

quantitative composition,

real-time PCR

Related subjects:

Life sciences,

Molecular biology,

Microbiology and virology,

Medicine,

Basic medical science,

Immunology

© 2023 Agnieszka Krawczyk, Katarzyna Talaga-Ćwiertnia, Katarzyna Biegun, Kamil Drożdż, Dominika Salamon, Tomasz Gosiewski, Agnieszka Sroka-Oleksiak, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Volume 77 (2023): Issue 1 (January 2023)

Quantitative evaluation of the genus Bifidobacterium in stool samples of patients with type 1 and 2 diabetes

Figures & Tables

Figure 1.

Sequences of primers, reaction mixture and amplification program used in the study

Characteristics of the studied patient groups

Paradigm

My account