Have a personal or library account? Click to login
Impact of Glucagon-like Peptide-1 Receptor Agonists on Intestinal Epithelial Cell Barrier Cover

Impact of Glucagon-like Peptide-1 Receptor Agonists on Intestinal Epithelial Cell Barrier

European Pharmaceutical Journal
Volume 71 (2024): Issue 1 (August 2024)
By: Y. Takizawa,  A. Kato,  A. Onsui,  S. Kanatanai,  A. Ishimura,  T. Kurita and  T. Nakajima  
Open Access
|Aug 2024

Figures & Tables

Figure 1.

Effects of semaglutide and dulaglutide on Caco-2 cells. (a, b) Cell proliferation, (c, d) cell viability, and (e, f) GLP-1 receptor protein expression. Data represent means and S.D. (n = 3-6 for each condition). *P <0.05 vs. the control (CTRL) condition
Effects of semaglutide and dulaglutide on Caco-2 cells. (a, b) Cell proliferation, (c, d) cell viability, and (e, f) GLP-1 receptor protein expression. Data represent means and S.D. (n = 3-6 for each condition). *P <0.05 vs. the control (CTRL) condition

Figure 2.

Effects of semaglutide and dulaglutide on mRNA expression levels of epithelial barrier function-related factors in Caco-2 cells. (a, b): ABCB1, (c, d): Claudin-4, and (e, f): Claudin-7. Exposure to a GLP-1 receptor agonist for 48 h (a, c, e) and 96 h (b, d, f). Data represent means and S.D. (n = 3 for each condition).
Effects of semaglutide and dulaglutide on mRNA expression levels of epithelial barrier function-related factors in Caco-2 cells. (a, b): ABCB1, (c, d): Claudin-4, and (e, f): Claudin-7. Exposure to a GLP-1 receptor agonist for 48 h (a, c, e) and 96 h (b, d, f). Data represent means and S.D. (n = 3 for each condition).

Figure 3.

Effects of semaglutide and dulaglutide on protein expression levels of epithelial barrier function-related factors in Caco-2 cells. (a, b): Typical bands for Western blotting, (c, d): P-gp, (e, f): Claudin-4, (g, h): Claudin-7, (i. j): MUC1, and (k, l): MUC2. Exposure to a GLP-1 receptor agonist for 48 h (a, c, e, g, i, k) and 96 h (b, d, f, h, j, l). Data represent means and S.D. (n = 3 for each condition). *P <0.05 vs. the control (CTRL) condition.
Effects of semaglutide and dulaglutide on protein expression levels of epithelial barrier function-related factors in Caco-2 cells. (a, b): Typical bands for Western blotting, (c, d): P-gp, (e, f): Claudin-4, (g, h): Claudin-7, (i. j): MUC1, and (k, l): MUC2. Exposure to a GLP-1 receptor agonist for 48 h (a, c, e, g, i, k) and 96 h (b, d, f, h, j, l). Data represent means and S.D. (n = 3 for each condition). *P <0.05 vs. the control (CTRL) condition.

Sequences of primers used for real-time RT-PCR

GeneSequence (5′-3′)Amplicon SizeGenBank ID
ABCB1ForwardCAGAGGGGATGGTCAGTGTT87 bpAF016535.1
ReverseCCTGACTCACCACACCAATG
Claudin-4ForwardCATCTCCTCTGTTCCGGGTA91 bpNM_001305.5
ReverseAAGGCCTCAGCCATACTCCT
Claudin-7ForwardCCCTCCACCTTTTGTTTGCC116 bpNM_001307.6
ReverseGCACAGGGAGTAGGATACGC
GAPDHForwardACCAGGGCTGCTTTTAACTCTG104 bpNM_001256799.3
ReverseTGGGTGGAATCATATTGGAACAT
DOI: https://doi.org/10.2478/afpuc-2024-0008 | Journal eISSN: 2453-6725
Journal RSS Feed
Language: English
Page range: 43 - 52
Submitted on: Jan 30, 2024
Accepted on: May 21, 2024
Published on: Aug 7, 2024
Published by: Comenius University in Bratislava, Faculty of Pharmacy
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year
Keywords:
GLP-1 receptor agonist,
intestinal epithelial barrier,
dulaglutide,
semaglutide,
Caco-2
Related subjects:
Pharmacy,
Pharmacy, other

© 2024 Y. Takizawa, A. Kato, A. Onsui, S. Kanatanai, A. Ishimura, T. Kurita, T. Nakajima, published by Comenius University in Bratislava, Faculty of Pharmacy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous articleVolume 71 (2024): Issue 1 (August 2024)Next article