Table 1
Sequences of primers used for real-time RT-PCR
| Gene | Sequence (5′-3′) | Amplicon Size | GenBank ID | |
|---|---|---|---|---|
| ABCB1 | Forward | CAGAGGGGATGGTCAGTGTT | 87 bp | AF016535.1 |
| Reverse | CCTGACTCACCACACCAATG | |||
| Claudin-4 | Forward | CATCTCCTCTGTTCCGGGTA | 91 bp | NM_001305.5 |
| Reverse | AAGGCCTCAGCCATACTCCT | |||
| Claudin-7 | Forward | CCCTCCACCTTTTGTTTGCC | 116 bp | NM_001307.6 |
| Reverse | GCACAGGGAGTAGGATACGC | |||
| GAPDH | Forward | ACCAGGGCTGCTTTTAACTCTG | 104 bp | NM_001256799.3 |
| Reverse | TGGGTGGAATCATATTGGAACAT | |||
Figure 1.
Effects of semaglutide and dulaglutide on Caco-2 cells. (a, b) Cell proliferation, (c, d) cell viability, and (e, f) GLP-1 receptor protein expression. Data represent means and S.D. (n = 3-6 for each condition). *P <0.05 vs. the control (CTRL) condition
Figure 2.
Effects of semaglutide and dulaglutide on mRNA expression levels of epithelial barrier function-related factors in Caco-2 cells. (a, b): ABCB1, (c, d): Claudin-4, and (e, f): Claudin-7. Exposure to a GLP-1 receptor agonist for 48 h (a, c, e) and 96 h (b, d, f). Data represent means and S.D. (n = 3 for each condition).
Figure 3.
Effects of semaglutide and dulaglutide on protein expression levels of epithelial barrier function-related factors in Caco-2 cells. (a, b): Typical bands for Western blotting, (c, d): P-gp, (e, f): Claudin-4, (g, h): Claudin-7, (i. j): MUC1, and (k, l): MUC2. Exposure to a GLP-1 receptor agonist for 48 h (a, c, e, g, i, k) and 96 h (b, d, f, h, j, l). Data represent means and S.D. (n = 3 for each condition). *P <0.05 vs. the control (CTRL) condition.