Have a personal or library account? Click to login
Identification of the respiratory tract infection due to methicillin-resistant Staphylococcus aureus by TaqMan real-time PCR Cover

Identification of the respiratory tract infection due to methicillin-resistant Staphylococcus aureus by TaqMan real-time PCR

Open Access
|Jun 2021

Figures & Tables

Figure 1

A distribution of MRSA among patients

Figure 2

The FAM channel of real-time PCR runs for the three specimens, and two controls (negative control and positive control). The progress of the amplification was shown by the three colored curves, one of which was positive control (red curve) and the other was positive results for the mecA gene (MRSA), and the two lines that appeared below the threshold line represent negative results for the mecA gene and the negative control

Real-time PCR test sensitivity, specificity, accuracy, and predictive values were measured in 142 MRSA and 34 control subjects

True positive*False negative*True negative*False positive*Sensitivity*Specificity*Accuracy*Predictive value of positive result*Predictive value of negative result*
138434097%100%98%100%89%

Primers and probes sequence data applied in current research for real-time PCR resistotyping of S_ aureus

Target gene symbol

Primer and probe sequences 5ʹ

Nucleotide positionsAliasesProduct size (BasePair)Source
nucForward primer:GTTGATACACCTGAAACAAAGCA 352-374SAR0847156Current study
Reverse primer:CGCTAAGCCACGTCCATATTTAT507-485
Probe:VIC-GGTCCTGAAGCAAGTGCATT-BHQ1400-419
mecAForward primer:GGAATGCAGAAAGACCAAAGC406-426SABB_RS00325126Current study
Reverse primer:CTTTGGAACGATGCCTATCTCA531-510
Probe:FAM-TGGCCAATACAGGAACAGCA-BHQ1488-507
Language: English
Page range: 86 - 92
Submitted on: May 8, 2021
|
Accepted on: May 29, 2021
|
Published on: Jun 28, 2021
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2021 Sabah Saad Abdulsahib, published by Foundation for Cell Biology and Molecular Biology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.