Have a personal or library account? Click to login
qPCR analysis of mesenchymal stem cell marker expression during the long-term culture of canine adipocyte derived stem cells Cover

qPCR analysis of mesenchymal stem cell marker expression during the long-term culture of canine adipocyte derived stem cells

Open Access
|Dec 2020

Figures & Tables

Figure 1

Photographs of morphological changes between the beginning and end-point of in vitro culture. Taken using an inverted microscope, using a relief contrast and 10x magnification.

Figure 2

The results of the flow cytometry analysis of the available canine ASC markers. The coloured peaks represent the cells stained by the specific antibodies, while the transparent peaks correspond to isotype controls.

Figure 3

The results of the RT-qPCR analysis of the change in expression of ASC specific markers during a 14-day primary culture of adipocyte derived stem cells. All data was presented as a log10 of fold change.

The sequences of primers used in the analysis

GENE NAMEFORWARD PRIMERREVERSE PRIMER
CD105CTCAGGTCCCCAATGCTACCGGTTGAAGGCCAGGTAGAGT
CD73CCCATTGACGAACGGAACAATATACCACGTGAATTCCGCC
CD14CACTAGAGCCCTGCGAAGTACGACGGCAATCATACACTGG
CD34ATGAGACCTCCAGCTGTGAGAGGTCAGACTGGTGCTTTCT
CD90CGAGAATGCTACCACCTTGCAGCCGGAGTTCACATGTGTA
CD45ACCTAGGCAAACATGTGAGGACTTCCAGATCAAAATTTCCACGA
HPRTCCATCACATCGTAGCCCTCACTTTTATATCGCCCGTTGAC
ACTBCCCTTGCCGCTCCGCCTTCGCAGCAATATCGGTCATCCAT
Language: English
Page range: 139 - 145
Submitted on: Oct 12, 2020
|
Accepted on: Nov 15, 2020
|
Published on: Dec 31, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 Rut Bryl, Claudia Dompe, Maurycy Jankowski, Katarzyna Stefańska, Afsaneh Golkar Narenji, Jakub Kulus, Magdalena Kulus, Maria Wieczorkiewicz, Grzegorz Wąsiatycz, Jędrzej M. Jaśkowski, Mariusz Kaczmarek, James N. Petitte, Paul Mozdziak, Paweł Antosik, Dorota Bukowska, published by Foundation for Cell Biology and Molecular Biology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.