Evaluation of the relationship between ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID-19 patients with and without lung involvement

Akcilar, Raziye; Kocak, Fatma Emel; Kar, Fatih; Isiklar, Ozben Ozden; Atlanoglu, Sahinde; Genc, Ozlem; Yaman, Fatima

doi:10.2478/abm-2024-0022

Figures & Tables

Electrophoresis of ACE2 G8709A (rs2285666) gene polymorphism by enzyme digestion product sizes were 466 bp for GG genotype, 185 bp–281 bp–466 bp for GA genotype, and 185 bp–281 bp for AA genotype. Lanes 1 and 2 are the GG genotype; lanes 3 and 4 are the GA genotype; lanes 5 and 6 are the AA genotype; lanes 7 and 8 are the PCR products (466 bp). ACE2, angiotensin-converting enzyme 2; M, DNA molecular weight marker.

Electrophoresis of AT2R A1675G (rs14035430) gene polymorphism by enzyme digestion product sizes were 310 bp for AA genotype, 104 bp–206 bp–310 bp for AG genotype, and 104 bp–206 bp for GG genotype. Lanes 1, 8, and 9 are the AA genotype; lanes 4, 5, and 7 are the AG genotype; lanes 2, 3, and 6 are the GG genotype. AT2R, angiotensin II type 2 receptor; M, DNA molecular weight marker.

Distribution of ACE2 (G8709A) and AT2R (A1675G) genotypes and alleles frequencies in COVID patients without/with lung involvement

		Control Group		Infected Group		OR (95% CI)	P-value	OR (95% CI)	P-value

		n = 80	%	n = 80	%
	GG	65	55.6	52	44.4	1	-	0.29 (0.10–0.84)	0.01^*
	GA	10	41.7	14	58.3	1.75 (0.72–4.26)	0.21	0.50 (0.14–1.84)	0.29
	AA	5	26.3	14	73.7	3.50 (1.18–10.3)	0.001^**	1	-
ACE2 G8709A (rs2285666)	χ² = 6.37, df = 2, P = 0.04^*
	G allele	140	54.3	118	45.7	1	-	0.40 (0.22–0.72)	0.001^**
	A allele	20	32.3	42	67.7	2.49 (1.39–4.48)	0.001^**	1	-
	χ² = 9.68, df = 1, P = 0.002^**
	AA	37	51.4	35	48.6	1.69 (0.76–3.76)	0.19	0.55 (0.26–1.15)	0.11
	AG	18	36.7	31	63.3	3.08 (1.28–7.38)	0.01^*	1
	GG	25	64.1	14	35.9	1	0.33 (0.14–0.78)	0.01^*
AT2R A1675G (rs14035430)	χ² = 6.60, df = 2, P = 0.03^*
	A allele	92	47.7	101	52.3	1.27 (0.81–1.98)	0.30	1
	G allele	68	53.5	59	46.5	1	0.79 (0.50–1.24)	0.30
	χ² = 1.05, df = 1, P = 0.30

Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients with lung involvement

Variables	Infected group (n = 80)

	ACE2 G8709A genotype				AT2R A1675G genotype

	GG	GA	AA	P-value	AA	AG	GG	P-value
Age (years)	42.2 ± 14.7	30.8 ± 14.3	51.8 ± 26.1	0.03^*	38.4 ± 16.7	44.4 ± 11.8	45.6 ± 17.1	0.22
WBC (10³/mm³)	6.63 ± 2.16	5.66 ± 1.91	6.00 ± 2.43	0.36	6.49 ± 2.04	6.86 ± 1.94	6.17 ± 2.46	0.58
PLT (10³/mm³)	228.4 ± 64.6	235.1 ± 51.7	179.0 ± 60.0	0.22	236.2 ± 618.9	228.3 ± 65.4	209.6 ± 51.3	0.26
Neutrophil (10³/μL)	4.35 ± 1.90	3.40 ± 1.81	4.08 ± 2.52	0.35	4.16 ± 2.03	4.54 ± 1.80	4.05 ± 1.91	0.69
Lymphocyte (10³/μL)	1.64 ± 0.78	1.72 ± 0.61	1.45 ± 1.23	0.83	1.71 ± 0.74	1.64 ± 0.72	1.52 ± 0.89	0.64
Eosinophil (10³/μL)	00.8 ± 0.08	0.06 ± 0.04	0.05 ± 0.05	0.53	0.07 ± 0.07	0.07 ± 0.08	0.07 ± 0.09	0.99
Hemoglobin (g/dL)	14.5 ± 1.83	13.2 ± 1.93	15.8 ± 0.92	0.02^*	14.3 ± 1.71	14.3 ± 2.29	14.6 ± 1.83	0.75
D-dimer (μg/mL)	491.4 ± 349.7	559.1 ± 566.6	654.6 ± 562.9	0.61	414.9 ± 340.8	641.4 ± 483.6	523.1 ± 303.8	0.08
Fibrinogen (mg/dL)	345.1 ± 129.6	312.7 ± 89.7	330.4 ± 87.1	0.73	324.4 ± 129.0	354.9 ± 132.9	352.0 ± 92.8	0.57
Ferritin (ng/mL)	93.6 ± 131.5	45.8 ± 59.0	154.8 ± 89.5	0.26	88.1 ± 144.3	95.4 ± 115.5	93.0 ± 90.8	0.97
CRP (mg/L)	17.9 ± 33.5	15.1 ± 19.7	42.6 ± 73.9	0.31	17.9 ± 40.5	27.0 ± 42.1	15.3 ± 18.7	0.55
AST (IU/L)	28.4 ± 18.6	23.4 ± 6.60	26.6 ± 5.36	0.68	24.9 ± 8.51	30.6 ± 20.0	29.6 ± 23.2	0.40
ALT (IU/L)	30.1 ± 27.7	20.7 ± 11.3	35.6 ± 29.3	0.49	25.1 ± 15.7	43.0 ± 46.1	25.7 ± 14.9	0.04^*
Creatinin (mg/dL)	0.98 ± 0.18	0.78 ± 0.12	1.05 ± 0.15	0.002^**	0.93 ± 0.18	1.02 ± 0.19	0.96 ± 0.18	0.22
Urea (mg/dL)	27.8 ± 8.75	21.5 ± 4.60	45.6 ± 28.7	<0.001^**	27.6 ± 9.00	26.4 ± 7.08	30.0 ± 16.3	0.56

Characteristics of the study population

Variables	Control Group n = 80	Infected Group n = 80	P-value
Sex (M/F) n (%)	42 (52.5)/38 (47.5)	39 (48.8)/41 (51.2)	0.63
Age (years)	41.3 ± 16.0	48.3 ± 16.7	0.20
WBC (10³/mm³)	6.47 ± 2.14	6.96 ± 3.26	0.008^**
PLT (10³/mm³)	226.1 ± 63.4	213.0 ± 57.4	0.44
Neutrophil (10³/μL)	4.21 ± 1.93	4.84 ± 2.80	0.023^*
Lymphocyte (10³/μL)	1.64 ± 0.78	1.60 ± 0.80	0.45
Eosinophil (10³/μL)	00.7 ± 0.08	0.05 ± 0.10	0.65
Hemoglobin (g/dL)	14.4 ± 1.87	13.9 ± 2.42	0.40
D-dimer (μg/mL)	510.0 ± 391.9	825.7 ± 818.3	<0.001^**
Fibrinogen (mg/dL)	340.1 ± 122.6	429.9 ± 126.2	0.07
Ferritin (ng/mL)	91.4 ± 123.8	253.3 ± 323.4	<0.001^**
CRP (mg/L)	19.1 ± 35.6	55.3 ± 67.3	<0.001^**
AST (IU/L)	27.6 ± 17.0	32.3 ± 15.8	0.25
ALT (IU/L)	29.3 ± 26.3	29.5 ± 15.5	0.34
Creatinin (mg/dL)	0.96 ± 0.18	1.04 ± 0.57	0.27
Urea (mg/dL)	28.1 ± 11.4	34.4 ± 22.3	0.018^*

Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients without lung involvement

Variables	Control Group (n = 80)

	ACE2 G8709A genotype				AT2R A1675G genotype

	GG	GA	AA	P-value	AA	AG	GG	P-value
Age (years)	49.9 ± 16.7	43.0 ± 17.6	48.0 ± 15.8	0.39	49.9 ± 17.2	45.3 ± 18.9	51.4 ± 7.90	0.43
WBC (10³/mm³)	7.21 ± 3.27	5.98 ± 2.02	6.98 ± 4.18	0.46	6.65 ± 2.50	7.06 ± 3.79	7.49 ± 3.83	0.70
PLT (10³/mm³)	213.2 ± 61.0	214.6 ± 48.2	210.5 ± 55.2	0.98	208.4 ± 55.3	217.6 ± 59.4	214.4 ± 61.0	0.80
Neutrophil (10³/μL)	5.08 ± 2.81	3.70 ± 1.68	5.06 ± 3.52	0.25	4.71 ± 2.39	4.74 ± 3.06	5.38 ± 3.31	0.73
Lymphocyte (10³/μL)	1.61 ± 0.84	1.78 ± 0.70	1.36 ± 0.71	0.39	1.45 ± 0.71	1.79 ± 0.98	1.55 ± 0.45	0.21
Eosinophil (10³/μL)	00.6 ± 0.12	0.04 ± 0.04	0.06 ± 0.09	0.82	0.05 ± 0.08	0.07 ± 0.14	0.04 ± 0.07	0.62
Hemoglobin (g/dL)	13.6 ± 2.70	14.4 ± 1.78	14.2 ± 1.75	0.47	13.6 ± 3.03	13.9 ± 1.88	14.3 ± 1.68	0.61
D-dimer (μg/mL)	988.3 ± 941.2	534.5 ± 386.6	513.1 ± 376.7	0.05^*	914.5 ± 1044.5	784.0 ± 381.8	696.2 ± 914.2	0.66
Fibrinogen (mg/dL)	455.9 ± 139.1	384.2 ± 97.9	379.2 ± 59.0	0.04^*	442.1 ± 131.5	425.7 ± 129.4	408.7 ± 109.4	0.69
Ferritin (ng/mL)	289.3 ± 374.0	164.2 ± 133.4	208.5 ± 230.1	0.37	297.9 ± 362.6	148.0 ± 179.0	374.7 ± 412.3	0.05^*
CRP (mg/L)	68.2 ± 76.6	32.1 ± 38.4	30.6 ± 32.7	0.06	67.4 ± 80.8	37.3 ± 44.8	65.0 ± 67.1	0.16
AST (IU/L)	34.0 ± 17.3	30.7 ± 13.9	27.1 ± 10.7	0.32	29.9 ± 14.1	29.3 ± 9.42	44.6 ± 24.6	0.005^**
ALT (IU/L)	31.7 ± 16.9	26.9 ± 12.2	23.6 ± 10.9	0.17	27.8 ± 16.1	26.0 ± 12.2	41.2 ± 15.7	0.005^**
Creatinin (mg/dL)	1.09 ± 0.69	0.96 ± 0.18	0.97 ± 0.27	0.67	1.16 ± 0.83	0.93 ± 0.21	0.99 ± 0.13	0.25
Urea (mg/dL)	36.6 ± 25.3	31.8 ± 17.3	28.7 ± 12.0	0.45	39.5 ± 29.9	30.1 ± 13.8	30.7 ± 10.8	0.19

Hardy–Weinberg equilibrium for ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID patients without/with lung involvement

Genotype	Observed	Expected	χ²	P-value	Alleles	Frequency
*ACE2*

Control group
GG	65	61.3	14.6	<0.001^**	G	0.13
GA	10	17.5			A	0.87
AA	5	1.3
Infected group
GG	52	43.5	24	<0.001^**	G	0.26
GA	14	31			A	0.74
AA	14	5.5

*AT2R*

Control group
AA	37	26.5	23.2	<0.001^**	A	0.43
AG	18	39.1			G	0.57
GG	25	14.5
Infected group
AA	35	31.9	2.24	0.133	A	0.37
AG	31	37.2			G	0.63
GG	14	10.9

Summary of conditions for the ACE2 G8790A and AT2R A1675G genetic analyses

	ACE2 G8790A (rs2285666)	AT2R A1675G (rs14035430)
Primer sequence (5′–3′)	F:CATGTGGTCAAAAGGATATCT	F:AGAGATCTGGTGCTATTACG
Primer sequence (5′–3′)	R:AAAGTAAGGTTGGCAGACAT	R:CACTTGAAGACTTACTGGTTG
PCR reaction conditions	94°C for 10 min 10 cycles of 94°C for 1 min, 65°C for 1 min, 72°C for 1 min 15 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min 20 cycles of 94°C for 1 min, 58°C for 1 min, 72°C for 1 min 72°C for 10 min.	95°C for 5 min 35 cycles of 94°C for 45 s, 55°C for 1 min, 72°C for 1 min 72°C for 7 min.
PCR product size	466 bp	310 bp
Restriction enzyme, incubation conditions	Alu I	HYP 188 III
Restriction enzyme, incubation conditions	37°C overnight	37°C overnight
Fragment length (bp)	GG: 466 bp	AA: 310 bp
	GA: 185 bp–281 bp–466 bp	GA: 104 bp–206 bp–310 bp
	AA: 185 bp–281 bp	GG: 104 bp–206 bp

Evaluation of the relationship between ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID-19 patients with and without lung involvement

Figures & Tables

Figure 1.

Figure 2.

Distribution of ACE2 (G8709A) and AT2R (A1675G) genotypes and alleles frequencies in COVID patients without/with lung involvement

Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients with lung involvement

Characteristics of the study population

Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients without lung involvement

Hardy–Weinberg equilibrium for ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID patients without/with lung involvement

Summary of conditions for the ACE2 G8790A and AT2R A1675G genetic analyses

Paradigm

My account