Have a personal or library account? Click to login
Evaluation of the relationship between ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID-19 patients with and without lung involvement Cover

Evaluation of the relationship between ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID-19 patients with and without lung involvement

Open Access
|Sep 2024

Figures & Tables

Figure 1.

Electrophoresis of ACE2 G8709A (rs2285666) gene polymorphism by enzyme digestion product sizes were 466 bp for GG genotype, 185 bp–281 bp–466 bp for GA genotype, and 185 bp–281 bp for AA genotype. Lanes 1 and 2 are the GG genotype; lanes 3 and 4 are the GA genotype; lanes 5 and 6 are the AA genotype; lanes 7 and 8 are the PCR products (466 bp). ACE2, angiotensin-converting enzyme 2; M, DNA molecular weight marker.

Figure 2.

Electrophoresis of AT2R A1675G (rs14035430) gene polymorphism by enzyme digestion product sizes were 310 bp for AA genotype, 104 bp–206 bp–310 bp for AG genotype, and 104 bp–206 bp for GG genotype. Lanes 1, 8, and 9 are the AA genotype; lanes 4, 5, and 7 are the AG genotype; lanes 2, 3, and 6 are the GG genotype. AT2R, angiotensin II type 2 receptor; M, DNA molecular weight marker.

Distribution of ACE2 (G8709A) and AT2R (A1675G) genotypes and alleles frequencies in COVID patients without/with lung involvement

Control GroupInfected GroupOR (95% CI)P-valueOR (95% CI)P-value



n = 80%n = 80%
GG6555.65244.41-0.29 (0.10–0.84)0.01*
GA1041.71458.31.75 (0.72–4.26)0.210.50 (0.14–1.84)0.29
AA526.31473.73.50 (1.18–10.3)0.001**1-
ACE2 G8709A (rs2285666)χ2 = 6.37, df = 2, P = 0.04*
G allele14054.311845.71-0.40 (0.22–0.72)0.001**
A allele2032.34267.72.49 (1.39–4.48)0.001**1-
χ2 = 9.68, df = 1, P = 0.002**
AA3751.43548.61.69 (0.76–3.76)0.190.55 (0.26–1.15)0.11
AG1836.73163.33.08 (1.28–7.38)0.01*1
GG2564.11435.910.33 (0.14–0.78)0.01*
AT2R A1675G (rs14035430)χ2 = 6.60, df = 2, P = 0.03*
A allele9247.710152.31.27 (0.81–1.98)0.301
G allele6853.55946.510.79 (0.50–1.24)0.30
χ2 = 1.05, df = 1, P = 0.30

Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients with lung involvement

VariablesInfected group (n = 80)

ACE2 G8709A genotypeAT2R A1675G genotype

GGGAAAP-valueAAAGGGP-value
Age (years)42.2 ± 14.730.8 ± 14.351.8 ± 26.10.03*38.4 ± 16.744.4 ± 11.845.6 ± 17.10.22
WBC (103/mm3)6.63 ± 2.165.66 ± 1.916.00 ± 2.430.366.49 ± 2.046.86 ± 1.946.17 ± 2.460.58
PLT (103/mm3)228.4 ± 64.6235.1 ± 51.7179.0 ± 60.00.22236.2 ± 618.9228.3 ± 65.4209.6 ± 51.30.26
Neutrophil (103/μL)4.35 ± 1.903.40 ± 1.814.08 ± 2.520.354.16 ± 2.034.54 ± 1.804.05 ± 1.910.69
Lymphocyte (103/μL)1.64 ± 0.781.72 ± 0.611.45 ± 1.230.831.71 ± 0.741.64 ± 0.721.52 ± 0.890.64
Eosinophil (103/μL)00.8 ± 0.080.06 ± 0.040.05 ± 0.050.530.07 ± 0.070.07 ± 0.080.07 ± 0.090.99
Hemoglobin (g/dL)14.5 ± 1.8313.2 ± 1.9315.8 ± 0.920.02*14.3 ± 1.7114.3 ± 2.2914.6 ± 1.830.75
D-dimer (μg/mL)491.4 ± 349.7559.1 ± 566.6654.6 ± 562.90.61414.9 ± 340.8641.4 ± 483.6523.1 ± 303.80.08
Fibrinogen (mg/dL)345.1 ± 129.6312.7 ± 89.7330.4 ± 87.10.73324.4 ± 129.0354.9 ± 132.9352.0 ± 92.80.57
Ferritin (ng/mL)93.6 ± 131.545.8 ± 59.0154.8 ± 89.50.2688.1 ± 144.395.4 ± 115.593.0 ± 90.80.97
CRP (mg/L)17.9 ± 33.515.1 ± 19.742.6 ± 73.90.3117.9 ± 40.527.0 ± 42.115.3 ± 18.70.55
AST (IU/L)28.4 ± 18.623.4 ± 6.6026.6 ± 5.360.6824.9 ± 8.5130.6 ± 20.029.6 ± 23.20.40
ALT (IU/L)30.1 ± 27.720.7 ± 11.335.6 ± 29.30.4925.1 ± 15.743.0 ± 46.125.7 ± 14.90.04*
Creatinin (mg/dL)0.98 ± 0.180.78 ± 0.121.05 ± 0.150.002**0.93 ± 0.181.02 ± 0.190.96 ± 0.180.22
Urea (mg/dL)27.8 ± 8.7521.5 ± 4.6045.6 ± 28.7<0.001**27.6 ± 9.0026.4 ± 7.0830.0 ± 16.30.56

Characteristics of the study population

VariablesControl Group n = 80Infected Group n = 80P-value
Sex (M/F) n (%)42 (52.5)/38 (47.5)39 (48.8)/41 (51.2)0.63
Age (years)41.3 ± 16.048.3 ± 16.70.20
WBC (103/mm3)6.47 ± 2.146.96 ± 3.260.008**
PLT (103/mm3)226.1 ± 63.4213.0 ± 57.40.44
Neutrophil (103/μL)4.21 ± 1.934.84 ± 2.800.023*
Lymphocyte (103/μL)1.64 ± 0.781.60 ± 0.800.45
Eosinophil (103/μL)00.7 ± 0.080.05 ± 0.100.65
Hemoglobin (g/dL)14.4 ± 1.8713.9 ± 2.420.40
D-dimer (μg/mL)510.0 ± 391.9825.7 ± 818.3<0.001**
Fibrinogen (mg/dL)340.1 ± 122.6429.9 ± 126.20.07
Ferritin (ng/mL)91.4 ± 123.8253.3 ± 323.4<0.001**
CRP (mg/L)19.1 ± 35.655.3 ± 67.3<0.001**
AST (IU/L)27.6 ± 17.032.3 ± 15.80.25
ALT (IU/L)29.3 ± 26.329.5 ± 15.50.34
Creatinin (mg/dL)0.96 ± 0.181.04 ± 0.570.27
Urea (mg/dL)28.1 ± 11.434.4 ± 22.30.018*

Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients without lung involvement

VariablesControl Group (n = 80)

ACE2 G8709A genotypeAT2R A1675G genotype

GGGAAAP-valueAAAGGGP-value
Age (years)49.9 ± 16.743.0 ± 17.648.0 ± 15.80.3949.9 ± 17.245.3 ± 18.951.4 ± 7.900.43
WBC (103/mm3)7.21 ± 3.275.98 ± 2.026.98 ± 4.180.466.65 ± 2.507.06 ± 3.797.49 ± 3.830.70
PLT (103/mm3)213.2 ± 61.0214.6 ± 48.2210.5 ± 55.20.98208.4 ± 55.3217.6 ± 59.4214.4 ± 61.00.80
Neutrophil (103/μL)5.08 ± 2.813.70 ± 1.685.06 ± 3.520.254.71 ± 2.394.74 ± 3.065.38 ± 3.310.73
Lymphocyte (103/μL)1.61 ± 0.841.78 ± 0.701.36 ± 0.710.391.45 ± 0.711.79 ± 0.981.55 ± 0.450.21
Eosinophil (103/μL)00.6 ± 0.120.04 ± 0.040.06 ± 0.090.820.05 ± 0.080.07 ± 0.140.04 ± 0.070.62
Hemoglobin (g/dL)13.6 ± 2.7014.4 ± 1.7814.2 ± 1.750.4713.6 ± 3.0313.9 ± 1.8814.3 ± 1.680.61
D-dimer (μg/mL)988.3 ± 941.2534.5 ± 386.6513.1 ± 376.70.05*914.5 ± 1044.5784.0 ± 381.8696.2 ± 914.20.66
Fibrinogen (mg/dL)455.9 ± 139.1384.2 ± 97.9379.2 ± 59.00.04*442.1 ± 131.5425.7 ± 129.4408.7 ± 109.40.69
Ferritin (ng/mL)289.3 ± 374.0164.2 ± 133.4208.5 ± 230.10.37297.9 ± 362.6148.0 ± 179.0374.7 ± 412.30.05*
CRP (mg/L)68.2 ± 76.632.1 ± 38.430.6 ± 32.70.0667.4 ± 80.837.3 ± 44.865.0 ± 67.10.16
AST (IU/L)34.0 ± 17.330.7 ± 13.927.1 ± 10.70.3229.9 ± 14.129.3 ± 9.4244.6 ± 24.60.005**
ALT (IU/L)31.7 ± 16.926.9 ± 12.223.6 ± 10.90.1727.8 ± 16.126.0 ± 12.241.2 ± 15.70.005**
Creatinin (mg/dL)1.09 ± 0.690.96 ± 0.180.97 ± 0.270.671.16 ± 0.830.93 ± 0.210.99 ± 0.130.25
Urea (mg/dL)36.6 ± 25.331.8 ± 17.328.7 ± 12.00.4539.5 ± 29.930.1 ± 13.830.7 ± 10.80.19

Hardy–Weinberg equilibrium for ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID patients without/with lung involvement

GenotypeObservedExpectedχ2P-valueAllelesFrequency
ACE2

Control group
GG6561.314.6<0.001**G0.13
GA1017.5 A0.87
AA51.3
Infected group
GG5243.524<0.001**G0.26
GA1431 A0.74
AA145.5

AT2R

Control group
AA3726.523.2<0.001**A0.43
AG1839.1 G0.57
GG2514.5
Infected group
AA3531.92.240.133A0.37
AG3137.2 G0.63
GG1410.9

Summary of conditions for the ACE2 G8790A and AT2R A1675G genetic analyses

ACE2 G8790A (rs2285666)AT2R A1675G (rs14035430)
Primer sequence (5′–3′)F:CATGTGGTCAAAAGGATATCTF:AGAGATCTGGTGCTATTACG
R:AAAGTAAGGTTGGCAGACATR:CACTTGAAGACTTACTGGTTG
PCR reaction conditions
  • 94°C for 10 min

  • 10 cycles of 94°C for 1 min, 65°C for 1 min, 72°C for 1 min

  • 15 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min

  • 20 cycles of 94°C for 1 min, 58°C for 1 min, 72°C for 1 min

  • 72°C for 10 min.

  • 95°C for 5 min

  • 35 cycles of 94°C for 45 s, 55°C for 1 min, 72°C for 1 min

  • 72°C for 7 min.

PCR product size466 bp310 bp
Restriction enzyme, incubation conditionsAlu IHYP 188 III
37°C overnight37°C overnight
Fragment length (bp)GG: 466 bpAA: 310 bp
GA: 185 bp–281 bp–466 bpGA: 104 bp–206 bp–310 bp
AA: 185 bp–281 bpGG: 104 bp–206 bp
DOI: https://doi.org/10.2478/abm-2024-0022 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415
Language: English
Page range: 157 - 170
Published on: Sep 20, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 6 issues per year

© 2024 Raziye Akcilar, Fatma Emel Kocak, Fatih Kar, Ozben Ozden Isiklar, Sahinde Atlanoglu, Ozlem Genc, Fatima Yaman, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution 4.0 License.