Have a personal or library account? Click to login
miR-30c-2-3p suppresses the proliferation of human renal cell carcinoma cells by targeting TOP2A Cover

miR-30c-2-3p suppresses the proliferation of human renal cell carcinoma cells by targeting TOP2A

Open Access
|Oct 2023

Figures & Tables

Figure 1.

miR-30c-2-3p expression in RCC cells. (A) The TCGA database was used to undertake an expression study of miR-30c-2-3p in RCC tissues (n = 241) and normal adjacent tissues (n = 70). (B) Analysis of the 5-year overall survival rate for RCC patients. (C) The expression of miR-30c-2-3p in RCC cell lines (786-O, Caki-1, and ACHN) and normal renal tubular epithelial cell line was examined using qRT-PCR (HK-2). ***P < 0.001.miR, microRNA; qRT-PCR, quantitative real-time polymerase chain reaction; RCC, renal cell carcinoma; TCGA, The Cancer Genome Atlas.

Figure 2.

RCC cells experience reduced proliferation and increased apoptosis when miR-30c-2-3p is expressed more typically. (A) miR-30c-2-3p expression after transfection. (B) Cell proliferation at 24 h, 48 h, and 72 h posttransfection. (C) After transfection, 786-O, Caki-1, and ACHN cells form colonies. (D) Analysis of apoptosis by flow cytometry following transfection with NC or miR-30c-2-3p mimics. (E) Fas, FasL, caspase 3, and caspase 8 protein expression in 786-O, Caki-1, and ACHN cells after miR-30c-2-3p mimic transfection or NC. *P < 0.05, **P < 0.01, ***P < 0.001. miR, microRNA; NC, negative control; RCC, renal cell carcinoma; TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.

Figure 3.

TOP2A is the direct target of miR-30c-2-3p. (A) Predicted binding site of miR-30c-2-3p in TOP2A mRNA 3′-UTR. (B) The sequences of wild-type (TOP2A W) and mutant (TOP2A M) genes. (C) Dual-luciferase reporter assay to determine the influence of miR-30c-2-3p on wild-type and mutant miR-30c-2-3p binding site on TOP2A 3‘-UTR. Cells transfected with miR-30c-2-3p overexpression plasmid and GLO plasmids were used as controls. (D, E) TOP2A mRNA and protein expression in 786-O, Caki-1, and ACHN cells following transfection with miR-30c-2-3p mimics or NC. **P < 0.01.miR, microRNA; NC, negative control TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.

Figure 4.

Expression of TOP2A in RCC tissues and cell lines. (A) Expression analysis of TOP2A in RCC tissues (n = 534) and normal adjacent tissues (n = 72) performed in TCGA database. (B) Five-year overall survival percentage analysis of patients with RCC. (C, D) TOP2A expression in 786-O, Caki-1, ACHN, and HE-2 cells. (E) TOP2A expression in RCC and adjacent tissues. **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; TCGA, The Cancer Genome Atlas; TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.

Figure 5.

TOP2A interference inhibits growth of RCC cells and promotes their apoptosis. ACHN, 786-O, and Caki-1 cells were transfected with shTOP2A-1, shTOP2A-2, or a negative control. (A, B) TOP2A mRNA and protein abundance after transfection. (C) Cell proliferation after transfection. (D) Colony formation in 786-O, Caki-1, and ACHN cells after transfection. (E) Study of apoptosis by flow cytometry following transfection with shTOP2A-1, shTOP2A-2, or a negative control. (F) Expression of Fas, FasL, caspase 8, and caspase 3 after transfection with shTOP2A-1, shTOP2A-2, or a negative control. *P < 0.05, **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; sh, short hairpin; TOP2A, DNA topoisomerase II alpha.

Figure 6.

RCC development regulated by miR-30c-2-3p is caused by TOP2A. (A, B) TOP2A expression in 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). (C, D) Viability and colony formation results of 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). (E) Apoptosis changes of 786-O, Caki-1, and ACHN cells pre-transfected with different RNAs for 48 h. (F) Abundance of Fas/FasL/caspase 8/caspase 3/Bcl2/caspase 9 proteina in 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). *P < 0.05, **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; sh, short hairpin; TOP2A, DNA topoisomerase II alpha.

Figure S1.

Transfection efficiency verification of miR-30c-2-3p inhibitor. (A) miR-30c-2-3p expression after transfection with NC or miR-30c-2-3p inhibitor. (B) The mRNA expression of TOP2A after transfection with NC or miR-30c-2-3p inhibitor. (C) TOP2A protein expression in 786-O, Caki-1, and ACHN cells after miR-30c-2-3p mimic transfection or NC. **P < 0.01, ***P < 0.001.miR, microRNA; TOP2A, DNA topoisomerase II alpha.

Primers used in this work

NameSequence (5′–3′)
TOP2A-RTTGGCATCATCGAGTTTGGGA
TOP2A-FTGGCTGTGGTATTGTAGAAAGC
GAPDH-FGACTTCAACAGCAACTCCCA
GAPDH-RTGGGTGGTCCAGGGTTTCTT
miR-30c-2-3p-RTGTCGTATCCAGTGCGTGTCGTGGA-GTCGGCAATTGCACTGGATACGACAGAGTAA
miR-30c-2-3p-FATCCAGTGCGTGTCGTG
miR-30c-2-3p-RTGCTCTGGGAGAAGGCTGT
U6-RTCGCTTCACGAATTTGCGTGTCAT
U6-RCGCTTCACGAATTTGCGTGTCAT
U6-FGCTTCGGCAGCACATATACTAAAAT
DOI: https://doi.org/10.2478/abm-2023-0052 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415
Language: English
Page range: 124 - 135
Published on: Oct 9, 2023
In partnership with: Paradigm Publishing Services
Publication frequency: 6 issues per year

© 2023 Xiaoyong Huang, Yuna Jia, Haiyan Shi, Haiyan Fan, Lingbo Sun, Huahua Zhang, Yanfeng Wang, Jie Chen, Jiaqi Han, Mingming Wang, Juan Du, Jing Zhang, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution 4.0 License.