Skip to main content
Have a personal or library account? Click to login
Acidic environment could modulate the interferon-γ expression: Implication on modulation of cancer and immune cells’ interactions Cover

Acidic environment could modulate the interferon-γ expression: Implication on modulation of cancer and immune cells’ interactions

By:  and    
Open Access
|Sep 2023

Figures & Tables

Figure 1.

Schematic representation of experimental set up. (A) To mimic the effect of acidic pH on immune cells, Jurkat cells were exposed to different pH conditions, pH 7.4, pH 6.9, and pH 6.5, for 24 h. Total mRNA was isolated for further experiments. (B) To ascertain the effect of cancer cells in the acidic environment on immune cells, Jurkat cells were cultured in HCM of pH 7.4, pH 6.9, and pH 6.5 for 24 h. Further, total mRNA was isolated from Jurkat cells for further experiments. Similar studies were performed for THP-1 also. HCM, HeLa cells conditioned medium.

Figure 2.

Schematic representation of experimental setup to ascertain the effect of the acidic environment in the restriction of immune response. Jurkat cells were stimulated with HCM at pH 7.4, pH 6.9, and pH 6.5 for 20 h. Cell-free media thus obtained were referred to as CM1 and saved for cytotoxic assessment against the HeLa cells. Jurkat cells obtained from this step were further subjected to reversal of pH by culturing the cells in a fresh medium of pH 7.4 for 4 h. After this, the media were extracted, referred to as CM2, and saved for cytotoxic assessment against the HeLa cells. A similar experiment was also carried out for THP-1. HCM, HeLa cells conditioned medium.

Figure 3.

Expression of IFN-γ under physiological pH (pH 7.4) and acidic environment (pH 6.9, pH 6.5) in Jurkat (A, C, E) and THP-1 (B, D, F) cells after 24 h incubation. (A, B) Semi-quantitative PCR of IFN-γ mRNA expression under physiological pH (pH 7.4) and acidic environment (pH 6.9, pH 6.5). Representative agarose gel of PCR amplified products from 1 of 3 independent similar experiments. (C, D) Quantitative real-time PCR analysis of IFN-γ mRNA expression under physiological pH (pH 7.4) and acidic environment (pH 6.9, pH 6.5). The delta CT method was used for relative quantification. For relative quantification, cells grown at pH 7.4 were taken as control. Data were normalized to β-actin. The specificity of reaction products was analyzed by melting curve analysis. The bar graph indicated the fold change in the expression of IFN-γ. (E, F) Representative histogram of flow cytometric analysis of anti–IFN-γ antibody stained Jurkat cells (E) and THP-1 cells (F). Mean fluorescence depicted the level of IFN-γ. Ten thousand events were counted per tube. Data are representative of 1 of 3 independent similar experiments. *P < 0.05. IFN-γ, interferon gamma.

Figure 4.

Expression of IFN-γ in Jurkat (A, C, E) and THP-1 (B, D, F) cells cultured in HCM at different pH (pH 7.4, pH 6.9, and pH 6.5). (A, B) Semi-quantitative PCR of IFN-γ mRNA expression in Jurkat and THP-1 cells cultured in HCM at pH 7.4, pH 6.9, and pH 6.5. Representative agarose gel of PCR amplified product from 1 of 3 independent similar experiments. (C, D) Quantitative real-time PCR analysis of altered IFN-γ mRNA level in Jurkat and THP-1 cells cultured in HCM at pH 7.4, pH 6.9, pH 6.5. For relative quantification, cells grown in HCM at pH 7.4 were taken as control. Data was normalized to β-actin. The specificity of the reaction products was analyzed by melting curve analysis (B) Representative histogram of flow cytometric analysis of IFN-γ stained Jurkat (C) and THP-1 (D) cells after treatment. Mean fluorescence depicted the level of IFN-γ. Ten thousand events were counted per tube. Data are representative of 1 of 3 independent similar experiments. HCM, HeLa cells conditioned medium; IFN-γ, interferon gamma.

Figure 5.

Altered relative expression of IFN-γ in Jurkat cells and THP-1 cells with and without stimulation with HCM at different pH values of 7.4, 6.9, and 6.5. A quantitative real-time PCR based comparison of IFN-γ produced by Jurkat cells (A) and THP-1 (B) cultured at different pH values (7.4, 6.9, and 6.5) and HCM at different pH (HCM pH 7.4, HCM pH 6.9, and HCM pH 6.5). *P < 0.05. HCM, HeLa cells conditioned medium; IFN-γ, interferon gamma.

Figure 6.

Effect of acidic microenvironment on the expression of IL-18 in HeLa cells. (A) Semi quantitative PCR analysis of IL-18 expression. epresentative agarose gel of PCR amplified product from 1 of 3 independent similar experiments. β-actin was used as an internal control. (B) Immunoblot analysis of IL-18 in exosome preparation from the culture medium of HeLa cells that were grown at different pH. Total exosome lysates were resolved on 10% SDS-PAGE for immunoblot analysis of IL-18 and CD63. CD63 was used as an exosome marker. IL-18, interleukin 18.

Figure 7.

Western blot analysis of subcellular localization of NF-κB and expression of p38 MAPK in THP-1 (A) and Jurkat (B) cells cultured in HCM at the various pH values of 7.4, 6.9, and 6.5 for 24 h. Total cell lysate or cell lysate after fractionation (nuclear fraction and cytoplasmic fraction) were resolved on 10% SDS-PAGE for immunoblot analysis of NF-κB and p38 MAPK. β-actin was taken as an internal control. The data represent 1 of 3 similar experiments. HCM, HeLa cells conditioned medium.

Figure 8.

A comparison of the cytotoxic activity of THP-1 (A) and Jurkat (B) against the HeLa cells after reverting the pH (7.4, 6.9, 6.5) to physiological pH (7.4). Cytotoxic activity was assessed by MTT assay. *P < 0.05.

Details of primers used in the study

GenePrimer sequence
IFN-γ5′ TCCCATGGGTTGTGTGTTTA 3′ (F)5′ AAGCACCAGGCATGAAATCT 3′ (R)
IL-185′ GCCTAGAGGTATGGCTGTAA 3′(F)5′ TTATCATGTCCTGGGACA 3′ (R)
IL-105′ AGGAGTCCTTGCTGGAGGA 3′ (F)5′ AAAGGCATTCTTCACCTG 3′ (R)
β-actin5′ GTGGGCCGCTCTAGGCACCA 3′ (F)5′ GGTTGGCCTTAGGGTTCAGGGGGG 3′ (R)
DOI: https://doi.org/10.2478/abm-2023-0047 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415
Language: English
Page range: 72 - 83
Published on: Sep 17, 2023
In partnership with: Paradigm Publishing Services

© 2023 Vishal Sharma, Jagdeep Kaur, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution 4.0 License.