Have a personal or library account? Click to login
Regulatory roles of lncRNA PANDAR in breast cancer cell proliferation Cover

Regulatory roles of lncRNA PANDAR in breast cancer cell proliferation

By: Qinnuan Sun and  Xiumei Wang  
Open Access
|Dec 2021

Figures & Tables

Figure 1

Screening of lncRNAs regulating the activity of the E-cad gene promoter. (A–E) The overexpression efficiency of a series of noncoding RNAs were detected by qRT-PCR. (F, G) Indicate lncRNA expression vectors, reporter plasmid containing human (F) or mouse (G) E-cad promoter and the internal control plasmid pRL-TK were cotransfected into HEK-293T cells. We measured luciferase activities 48 h after transfection. The ratio of firefly-to-Renilla luciferase activity was calculated and results were normalized to the corresponding negative control. Data are represented as the mean ± SD of triplicate assays. E-cad, E-cadherin; lncRNAs, long noncoding RNAs; SD, standard deviation.

Figure 2

PANDAR suppress the expression of E-cad while simultaneously upregulating the expression of N-cad at the protein level. To obtain stable cell lines expressing PANDAR and corresponding control, lentiviruses were used to infect MCF-7 cells. (A) qRT-PCR were used to determine the overexpression efficiency of PANAR in MCF-7 cells. Data are represented as the mean ± SD of triplicate assays. (B) Western blotting was performed to determine the expression profile of EMT biomarkers, including E-cad and N-cad protein. Tubulin served as an internal control. E-cad, E-cadherin; EMT, epithelial-mesenchymal transition; MCF-7, Michigan cancer foundation-7; N-cad, N-cadherin; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.

Figure 3

MCF-7 cell proliferation is significantly increased after PANDAR overexpression. (A) Different treatments of MCF-7 cells were seeded at the same density and photographed under a microscope 3 days later. (B) PANDAR overexpression in MCF-7 cells through a lentiviral vector. PANDAR overexpressing cells and control cells were plated at the same density followed by a CCK-8 assay to quantify cell proliferation. Three days after plating, the MCF-7 cells overexpressing PANDAR had proliferated significantly. Each experiment was repeated 4 times. Data are represented as the mean ± SD. CCK-8, cell counting kit-8; MCF-7, Michigan cancer foundation-7; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.

Primer sequences_

Upstream primer sequence (5′–3′)Downstream primer sequence (5′–3′)
HOTAIRCAAGCTTCGAATTACGAATTCGACTCGCCTGTGCTCTGGAGCTTGTTATCTAGAGTCGCGGGATCGGAAAATGCATCCAGATATTAATAT
TCONS00068220CAAGCTTCGAATTACGAATTCCCGACTTTCACTTATCAGACCTTGTTATCTAGAGTCGCGGGATCGGGTGAGCAGTTTTTATTAACCTGT
PANDARCAAGCTTCGAATTACGAATTCTTTCAGGAATGCCGCAGATGTACATTATCTAGAGTCGCGGGATCGCAGTGGCTCACGCCTGTAATCTCA
DOI: https://doi.org/10.2478/abm-2021-0035 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415
Language: English
Page range: 285 - 291
Published on: Dec 30, 2021
In partnership with: Paradigm Publishing Services
Publication frequency: 6 issues per year

© 2021 Qinnuan Sun, Xiumei Wang, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution 4.0 License.