
Figure 1
Screening of lncRNAs regulating the activity of the E-cad gene promoter. (A–E) The overexpression efficiency of a series of noncoding RNAs were detected by qRT-PCR. (F, G) Indicate lncRNA expression vectors, reporter plasmid containing human (F) or mouse (G) E-cad promoter and the internal control plasmid pRL-TK were cotransfected into HEK-293T cells. We measured luciferase activities 48 h after transfection. The ratio of firefly-to-Renilla luciferase activity was calculated and results were normalized to the corresponding negative control. Data are represented as the mean ± SD of triplicate assays. E-cad, E-cadherin; lncRNAs, long noncoding RNAs; SD, standard deviation.

Figure 2
PANDAR suppress the expression of E-cad while simultaneously upregulating the expression of N-cad at the protein level. To obtain stable cell lines expressing PANDAR and corresponding control, lentiviruses were used to infect MCF-7 cells. (A) qRT-PCR were used to determine the overexpression efficiency of PANAR in MCF-7 cells. Data are represented as the mean ± SD of triplicate assays. (B) Western blotting was performed to determine the expression profile of EMT biomarkers, including E-cad and N-cad protein. Tubulin served as an internal control. E-cad, E-cadherin; EMT, epithelial-mesenchymal transition; MCF-7, Michigan cancer foundation-7; N-cad, N-cadherin; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.

Figure 3
MCF-7 cell proliferation is significantly increased after PANDAR overexpression. (A) Different treatments of MCF-7 cells were seeded at the same density and photographed under a microscope 3 days later. (B) PANDAR overexpression in MCF-7 cells through a lentiviral vector. PANDAR overexpressing cells and control cells were plated at the same density followed by a CCK-8 assay to quantify cell proliferation. Three days after plating, the MCF-7 cells overexpressing PANDAR had proliferated significantly. Each experiment was repeated 4 times. Data are represented as the mean ± SD. CCK-8, cell counting kit-8; MCF-7, Michigan cancer foundation-7; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.
Table 1
Primer sequences.
| Upstream primer sequence (5′–3′) | Downstream primer sequence (5′–3′) | |
|---|---|---|
| HOTAIR | CAAGCTTCGAATTACGAATTCGACTCGCCTGTGCTCTGGAGCTTG | TTATCTAGAGTCGCGGGATCGGAAAATGCATCCAGATATTAATAT |
| TCONS00068220 | CAAGCTTCGAATTACGAATTCCCGACTTTCACTTATCAGACCTTG | TTATCTAGAGTCGCGGGATCGGGTGAGCAGTTTTTATTAACCTGT |
| PANDAR | CAAGCTTCGAATTACGAATTCTTTCAGGAATGCCGCAGATGTACA | TTATCTAGAGTCGCGGGATCGCAGTGGCTCACGCCTGTAATCTCA |