Have a personal or library account? Click to login
Regulatory roles of lncRNA PANDAR in breast cancer cell proliferation Cover

Regulatory roles of lncRNA PANDAR in breast cancer cell proliferation

Asian Biomedicine
Volume 15 (2021): Issue 6 (December 2021)
By: Qinnuan Sun and  Xiumei Wang  
Open Access
|Dec 2021

Figures & Tables

Figure 1

Screening of lncRNAs regulating the activity of the E-cad gene promoter. (A–E) The overexpression efficiency of a series of noncoding RNAs were detected by qRT-PCR. (F, G) Indicate lncRNA expression vectors, reporter plasmid containing human (F) or mouse (G) E-cad promoter and the internal control plasmid pRL-TK were cotransfected into HEK-293T cells. We measured luciferase activities 48 h after transfection. The ratio of firefly-to-Renilla luciferase activity was calculated and results were normalized to the corresponding negative control. Data are represented as the mean ± SD of triplicate assays. E-cad, E-cadherin; lncRNAs, long noncoding RNAs; SD, standard deviation.
Screening of lncRNAs regulating the activity of the E-cad gene promoter. (A–E) The overexpression efficiency of a series of noncoding RNAs were detected by qRT-PCR. (F, G) Indicate lncRNA expression vectors, reporter plasmid containing human (F) or mouse (G) E-cad promoter and the internal control plasmid pRL-TK were cotransfected into HEK-293T cells. We measured luciferase activities 48 h after transfection. The ratio of firefly-to-Renilla luciferase activity was calculated and results were normalized to the corresponding negative control. Data are represented as the mean ± SD of triplicate assays. E-cad, E-cadherin; lncRNAs, long noncoding RNAs; SD, standard deviation.

Figure 2

PANDAR suppress the expression of E-cad while simultaneously upregulating the expression of N-cad at the protein level. To obtain stable cell lines expressing PANDAR and corresponding control, lentiviruses were used to infect MCF-7 cells. (A) qRT-PCR were used to determine the overexpression efficiency of PANAR in MCF-7 cells. Data are represented as the mean ± SD of triplicate assays. (B) Western blotting was performed to determine the expression profile of EMT biomarkers, including E-cad and N-cad protein. Tubulin served as an internal control. E-cad, E-cadherin; EMT, epithelial-mesenchymal transition; MCF-7, Michigan cancer foundation-7; N-cad, N-cadherin; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.
PANDAR suppress the expression of E-cad while simultaneously upregulating the expression of N-cad at the protein level. To obtain stable cell lines expressing PANDAR and corresponding control, lentiviruses were used to infect MCF-7 cells. (A) qRT-PCR were used to determine the overexpression efficiency of PANAR in MCF-7 cells. Data are represented as the mean ± SD of triplicate assays. (B) Western blotting was performed to determine the expression profile of EMT biomarkers, including E-cad and N-cad protein. Tubulin served as an internal control. E-cad, E-cadherin; EMT, epithelial-mesenchymal transition; MCF-7, Michigan cancer foundation-7; N-cad, N-cadherin; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.

Figure 3

MCF-7 cell proliferation is significantly increased after PANDAR overexpression. (A) Different treatments of MCF-7 cells were seeded at the same density and photographed under a microscope 3 days later. (B) PANDAR overexpression in MCF-7 cells through a lentiviral vector. PANDAR overexpressing cells and control cells were plated at the same density followed by a CCK-8 assay to quantify cell proliferation. Three days after plating, the MCF-7 cells overexpressing PANDAR had proliferated significantly. Each experiment was repeated 4 times. Data are represented as the mean ± SD. CCK-8, cell counting kit-8; MCF-7, Michigan cancer foundation-7; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.
MCF-7 cell proliferation is significantly increased after PANDAR overexpression. (A) Different treatments of MCF-7 cells were seeded at the same density and photographed under a microscope 3 days later. (B) PANDAR overexpression in MCF-7 cells through a lentiviral vector. PANDAR overexpressing cells and control cells were plated at the same density followed by a CCK-8 assay to quantify cell proliferation. Three days after plating, the MCF-7 cells overexpressing PANDAR had proliferated significantly. Each experiment was repeated 4 times. Data are represented as the mean ± SD. CCK-8, cell counting kit-8; MCF-7, Michigan cancer foundation-7; PANDAR, promoter of CDKN1A antisense DNA damage-activated RNA; SD, standard deviation.

Primer sequences_

Upstream primer sequence (5′–3′)Downstream primer sequence (5′–3′)
HOTAIRCAAGCTTCGAATTACGAATTCGACTCGCCTGTGCTCTGGAGCTTGTTATCTAGAGTCGCGGGATCGGAAAATGCATCCAGATATTAATAT
TCONS00068220CAAGCTTCGAATTACGAATTCCCGACTTTCACTTATCAGACCTTGTTATCTAGAGTCGCGGGATCGGGTGAGCAGTTTTTATTAACCTGT
PANDARCAAGCTTCGAATTACGAATTCTTTCAGGAATGCCGCAGATGTACATTATCTAGAGTCGCGGGATCGCAGTGGCTCACGCCTGTAATCTCA
DOI: https://doi.org/10.2478/abm-2021-0035 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415
Journal RSS Feed
Language: English
Page range: 285 - 291
Published on: Dec 30, 2021
Published by: Chulalongkorn University
In partnership with: Paradigm Publishing Services
Publication frequency: 6 issues per year
Keywords:
breast neoplasms,
epithelial-mesenchymal transition,
long noncoding RNA PANDAR,
human,
cell proliferation
Related subjects:
Medicine,
Assistive professions, nursing,
Basic medical science,
Basic medical science, other,
Clinical medicine,
Clinical medicine, other

© 2021 Qinnuan Sun, Xiumei Wang, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous articleVolume 15 (2021): Issue 6 (December 2021)Next article