Skip to main content
Have a personal or library account? Click to login
PRKAA2 variation and the clinical characteristics of patients newly diagnosed with type 2 diabetes mellitus in Yogyakarta, Indonesia Cover

PRKAA2 variation and the clinical characteristics of patients newly diagnosed with type 2 diabetes mellitus in Yogyakarta, Indonesia

Open Access
|Aug 2021

Figures & Tables

Table 1

Context sequence (VIC/FAM) rs2796498, rs9803799, and rs2746342

SNP ID*Context sequence (VIC/FAM dye)
rs2796498CTGTAACAGTGTTAGTGATTTAAAC[A/G]
GAGAGAGCAACCTTACCCTTTCAGT
rs9803799TAAATACAGGGTTTATATCCCCACA[G/T]
TCAATGTAAATTCCTTTTTTTAAAA
rs2746342AGAGAGGCTAAGATGCAGGCTGTAC[G/T]
CTGGGTAGCCATGTACTCAGTTGTA

* TaqMan SNP Genotyping Assays by Applied Biosystems (Thermo Fisher Scientific).

SNP, single point mutation.

Table 2

Baseline characteristics of the patients with T2DM

Characteristics(n = 166)
Age (years)54.0 ± 9.7
Sex (female)117 (70.5)
Systolic blood pressure (mmHg)130.4 ± 18.7
Diastolic blood pressure (mmHg)81.1 ± 8.7
BMI (kg/m2)25.0 ± 4.0
Waist circumference (cm)87.6 ± 9.2
FPG (mg/dL)189.0 ± 71.2
HbA1c (%)9.61 ± 2.32
CrSr (mg/dL)0.89 ± 0.80
eGFR (mL/min/1.73 m2)91.6 ± 26.7

[i] Continuous variables are presented as mean ± standard deviation, sex is presented as n (%).

[ii] BMI, body mass index; CrSr, serum creatinine; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; T2DM, type 2 diabetes mellitus.

Figure 1

Distribution of PRKAA2 genotype rs2796498, rs9803799, and rs2746342 in patients newly diagnosed with T2DM in Yogyakarta, Indonesia; PRKAA2 (NCBI gene ID: 5563), which encodes protein kinase adenosine monophosphate (AMP)-activated (EC 2.7.11.31) α2 catalytic subunit (AMPKα2); SNP, single nucleotide polymorphism; T2DM, type 2 diabetes mellitus.

Table 3

Clinical characteristics of patients with T2DM patients based on PRKAA2genetic variation

Clinical Characteristicrs2796498 (HWE 0.35)
n (%)
Prs9803799 (HWE 0.08)
n (%)
Prs2746342 (HWE 0.36)
n (%)
P
GG 95 (57.2)AG 64 (38.6)AA 7 (4.2)TT 147 (88.6)GT 17 (10.2)GG 2 (1.2)GG 55 (33.1)GT 86 (51.8)TT 25 (15.1)
Age (years)53.3 ± 9.554.7 ± 10.255.7 ± 10.10.6054.1 ± 9.653.7 ± 11.345.0 ± 2.80.4254.3 ± 9.653.7 ± 9.854.0 ± 10.20.94
BMI (kg/m2)24.95 ± 3.7824.83 ± 4.2027.14 ± 5.400.3525.06 ± 4.0324.53 ± 4.0924.50 ± 3.540.8724.60 ± 4.2025.23 ± 3.6925.09 ± 4.730.66
WC (cm)87.4 ± 8.787.6 ± 10.191.0 ± 8.10.6187.4 ± 9.590.1 ± 6.585.5 ± 3.50.4986.6 ± 9.288.2 ± 9.688.0 ± 7.90.58
SBP (mmHg)129.5 ± 19.1131.3 ± 18.5136.4 ± 15.00.57131.1 ± 18.9125.7 ± 14.8124.0 ± 33.90.47127.4 ± 19.7131.8 ± 18.2132.9 ± 17.70.31
DBP (mmHg)81.2 ± 8.981.1 ± 8.580.4 ± 9.60.9881.3 ± 8.279.6 ± 12.382.0 ± 17.00.7480.0 ± 9.581.8 ± 8.681.3 ± 7.20.51
FPG (mg/dL)188.8 ± 72.2191.8 ± 70.8167.9 ± 68.10.70188.5 ± 70.0195.5 ± 83.1196.0 ± 103.20.97186.5 ± 75.2189.6 ± 68.8192.7 ± 73.10.93
HbA1c (%)9.65 ± 2.309.61 ± 2.358.97 ± 2.430.769.61 ± 2.259.66 ± 2.858.9 ± 3.400.919.42 ± 2.309.79 ± 2.329.39 ± 2.890.58
CrSr (mg/dL)0.81 ± 0.491.04 ± 1.130.66 ± 0.100.480.87 ± 0.621.13 ± 1.750.67 ± 0.130.370.83 ± 0.520.97 ± 1.010.80 ± 0.330.48
eGFR (mL/min)94.0 ± 24.787.5 ± 30.296.6 ± 13.10.6691.5 ± 26.290.7 ± 32.6111.5 ± 3.50.5792.1 ± 24.690.9 ± 29.093.0 ± 23.70.93

[i] Data were analyzed using a one-way ANOVA or Kruskal–Wallis test, as appropriate.

[ii] BMI, body mass index; CrSr, serum creatinine; DBP, diastolic blood pressure; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; HWE, Hardy–Weinburg equilibrium; SBP, systolic blood pressure; T2DM, type 2 diabetes mellitus; WC, waist circumference.

Table 4

Association between PRKAA2 genetic variation and clinical characteristics of patients with T2DM

GenotypeOR (95%CI)
FPGHbA1cCrSreGFRBlood pressureObesity status
rs2796498
GG1 (Reference)
AG1.24 (0.66–2.34)0.90 (0.48–1.71)1.74 (0.86–3.51)2.51 (0.96–6.54)0.98 (0.51–1.92)1.18 (0.63–2.23)
AA0.99 (0.21–4.69)0.46 (0.09–2.51)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.41 (0.30–6.68)1.48 (0.31–6.98)
Dominant (GG vs. AG+AA)1.21 (0.65–1.26)0.85 (0.46–1.58)1.49 (0.75–2.98)2.21 (0.85–5.74)1.02 (0.54–1.95)1.21 (0.65–2.24)
Recessive (GG+AG vs. AA)0.91 (0.20–4.18)0.48 (0.09–2.57)<0.01 (<0.01–NA)<0.01 (<0.00–NA)1.42 (0.31–6.56)1.39 (0.30–6.39)
G allele1 (Reference)
A allele1.13 (0.68–1.87)0.83 (0.50–1.38)1.19 (0.64–1.97)1.47 (0.71–3.04)1.06 (0.62–1.80)1.18 (0.71–1.96)
rs9803799
TT1 (Reference)
GT1.10 (0.40–2.98)0.86 (0.31–2.38)0.82 (0.25–2.67)1.64 (0.43–6.29)0.55 (0.17–1.76)0.90 (0.33–2.46)
GG1.23 (0.08–19.99)1.23 (0.08–19.99)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.77 (0.11–28.94)1.01 (0.06–16.51)
Dominant (TT vs. GT+GG)1.11 (0.42–2.88)0.89 (0.34–2.35)0.71 (0.22–2.28)1.43 (0.38–5.44)0.63 (0.22–1.86)0.91 (0.35–2.38)
Recessive (TT+GT vs. GG)1.22 (0.08–19.78)1.25 (0.08–20.27)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.88 (0.12–30.57)1.03 (0.06–16.66)
T allele1 (Reference)
G allele1.11 (0.46–2.69)0.93 (0.38–2.27)0.64 (0.21–1.94)1.23 (0.35–4.39)0.73 (0.28–1.94)0.93 (0.38–2.24)
rs2746342
GG1 (Reference)
GT1.43 (0.72–2.84)1.55 (0.78–3.08)0.95 (0.43–2.06)2.48 (0.77–7.97)1.44 (0.70–2.99)1.90 (0.95–3.77)
TT1.18 (0.45–3.07)1.23 (0.49–3.32)1.65 (0.60–4.56)1.11 (0.19–6.49)1.63 (0.60–4.37)1.39 (0.53–3.59)
Dominant (GG vs. GT+TT)1.37 (0.71–2.64)1.48 (0.77–2.86)1.09 (0.52–2.27)2.15 (0.68–6.76)1.48 (0.74–2.98)1.77 (0.92–3.40)
Recessive (GG+GT vs. TT)0.95 (0.40–2.23)0.97 (0.41–2.29)1.70 (0.70–4.20)0.59 (0.13–6.16)1.29 (0.54–3.09)1.94 (0.40–2.19)
G allele1 (Reference)
T allele1.14 (0.73–1.76)1.19 (0.76–1.84)1.21 (0.74–1.97)1.21 (0.62–2.35)1.28 (0.81–2.02)1.27 (0.82–1.97)

[i] AMP, adenosine monophosphate; AMPKα2, AMP-activated protein kinase (EC 2.7.11.31) α2 catalytic subunit; CI, confidence interval; CrSr, serum creatinine; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; NA, not available; OR, odds ratio; PRKAA2 (NCBI gene ID: 5563), which encodes AMPKα2; T2DM, type 2 diabetes mellitus.

Table 5

Multiple regression logistic analysis adjusted for age and sex

GenotypeOR (95%CI)
FPGHbA1cCrSreGFRBlood pressureObesity status
rs2796498
GG1 (Reference)
AG1.27 (0.67–2.41)0.96 (0.50–1.85)1.79 (0.81–3.94)2.38 (0.87–6.50)0.95 (0.48–1.86)1.20 (0.64–2.28)
AA1.03 (0.22–4.89)0.44 (0.08–2.48)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.27 (0.26–6.14)1.49 (0.31–7.07)
Dominant (GG vs. AG+AA)1.24 (0.67–2.32)0.89 (0.47–1.69)1.51 (0.70–3.29)2.08 (0.77–5.67)0.98 (0.51–1.88)1.23 (0.66–2.28)
Recessive (GG+AG vs. AA)0.93 (0.20–4.34)0.45 (0.08–2.48)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.30 (0.28–6.13)1.38 (0.30–6.42)
G allele1 (Reference)
A allele1.15 (0.69–1.92)0.85 (0.50–1.44)1.11 (0.59–2.09)1.34 (0.65–3.00)1.02 (0.59–1.74)1.19 (0.72–1.98)
rs9803799
TT1 (Reference)
GT1.08 (0.39–2.98)0.79 (0.27–2.27)0.86 (0.22–3.33)1.67 (0.39–7.14)0.54 (0.17–1.74)0.89 (0.32–2.44)
GG1.06 (0.06–17.61)1.07 (0.06–17.93)<0.01 (<0.01–NA)<0.01 (0.01–NA)2.52 (0.15–42.41)0.96 (0.06–15.95)
Dominant (TT vs. GT+GG)1.08 (0.41–2.83)0.81 (0.30–2.21)0.72 (0.19–2.70)1.53 (0.37–6.43)0.65 (0.22–1.91)0.90 (0.34–2.34)
Recessive (TT+GT vs. GG)1.05 (0.06–17.44)1.03 (0.06–18.30)<0.01 (<0.01–NA)<0.01 (0.01–NA)2.66 (0.16–44.71)0.97 (0.06–16.11)
T allele1 (Reference)
G allele1.07 (0.44–2.61)0.71 (0.84–2.12)0.63 (0.18–2.22)1.38 (0.35–5.39)0.77 (0.29–2.06)0.91 (0.37–2.21)
rs2746342
GG1 (Reference)
GT1.42 (0.71–2.83)1.55 (0.76–3.14)0.99 (0.42–2.37)2.81 (0.83–9.51)1.48 (0.71–3.09)1.89 (0.95–3.76)
TT1.17 (0.45–3.06)1.30 (0.48–3.47)1.88 (0.59–5.95)1.04 (0.16–6.65)1.67 (0.61–4.54)1.39 (0.54–3.60)
Dominant (GG vs. GT+TT)1.36 (0.71–2.63)1.49 (0.75–2.93)1.16 (0.51–2.63)2.34 (0.71–7.71)1.52 (0.75–3.07)1.76 (0.91–3.40)
Recessive (GG+GT vs. TT)0.95 (0.40–2.23)0.99 (0.41–2.40)1.89 (0.68–5.26)0.52 (0.10–2.62)1.31 (0.54–3.16)0.94 (0.40–2.21)
G allele1 (Reference)
T allele1.13 (0.73–1.76)1.20 (0.76–1.87)1.28 (0.73–2.21)1.22 (0.61–2.45)1.03 (0.82–2.06)1.27 (0.82–1.97)

[i] CI, confidence interval; CrSr, serum creatinine; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; NA, not available; OR, odds ratio.

Table 6

Multiple regression logistic analysis adjusted for age, sex, and waist circumference

GenotypeOR (95%CI)
FPGHbA1cCrSreGFRBlood pressureObesity status
rs2796498
GG1 (Reference)
AG1.29 (0.67–2.45)0.97 (0.50–1.87)1.79 (0.81–3.96)2.38 (0.87–6.49)0.92 (0.46–1.84)1.31 (0.60–2.87)
AA1.14 (0.24–5.46)0.48 (0.09–2.71)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.08 (0.22–5.25)0.89 (0.14–5.49)
Dominant (GG vs. AG+AA)1.27 (0.68–2.38)0.91 (0.48–1.72)1.51 (0.70–3.29)2.09 (0.77–5.68)0.94 (0.48–1.83)1.26 (0.59–2.67)
Recessive (GG+AG vs. AA)1.03 (0.22–4.81)0.49 (0.09–2.69)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.11 (0.23–5.29)0.80 (0.13–4.84)
G allele1 (Reference)
A allele1.18 (0.70–1.97)0.87 (0.51–1.47)1.11 (0.59–2.09)1.40 (0.65–3.03)0.97 (0.56–1.68)1.14 (0.61–2.13)
rs9803799
TT1 (Reference)
GT1.17 (0.42–3.24)0.83 (0.29–2.43)0.84 (0.22–3.31)1.82 (0.42–7.92)0.45 (0.14–1.51)0.50 (0.15–1.62)
GG0.99 (0.06–16.53)0.95 (0.05–16.76)<0.01 (<0.01–NA)<0.01 (<0.01–NA)3.06 (0.18–52.68)1.38 (0.07–26.18)
Dominant (TT vs. GT+GG)1.15 (0.43–3.03)0.85 (0.31–2.33)0.71 (0.19–2.68)1.64 (0.39–6.99)0.57 (0.19–1.72)0.57 (0.19–1.72)
Recessive (TT+GT vs. GG)0.98 (0.06–16.27)0.97 (0.06–17.00)<0.01 (<0.01–NA)<0.01 (<0.01–NA)3.24 (0.19–55.53)1.46 (0.08–27.28)
T allele1 (Reference)
G allele1.12 (0.46–2.74)0.87 (0.34–2.19)0.62 (0.18–2.20)1.45 (0.37–5.68)0.71 (0.26–1.92)0.65 (0.24–1.78)
rs2746342
GG1 (Reference)
GT1.49 (0.75–2.99)1.63 (0.79–3.34)0.99 (0.41–2.36)2.87 (0.85–9.72)1.39 (0.66–2.95)1.94 (0.84–4.49)
TT1.23 (0.47–3.22)1.35 (0.50–3.66)1.87 (0.59–5.93)1.05 (0.16–6.77)1.60 (0.58–4.43)1.33 (0.43–4.11)
Dominant (GG vs. GT+TT)1.43 (0.73–2.78)1.56 (0.79–3.11)1.15 (0.50–2.63)2.39 (0.72–7.87)1.44 (0.70–2.95)1.77 (0.80–3.92)
Recessive (GG+GT vs. TT)0.96 (0.40–2.27)0.99 (0.41–2.42)1.89 (0.68–5.25)0.52 (0.10–2.63)1.30 (0.53–3.20)0.89 (0.33–2.44)
G allele1 (Reference)
T allele1.16 (0.74–1.81)1.22 (0.77–1.93)1.27 (0.73–2.21)1.23 (0.61–2.48)1.26 (0.79–2.02)1.25 (0.74–2.13)

[i] P < 0.05 is considered significant.

[ii] CI, confidence interval; CrSr, serum creatinine; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; NA, not available; OR, odds ratio; WC, waist circumference.

DOI: https://doi.org/10.2478/abm-2021-0021 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415
Language: English
Page range: 161 - 170
Published on: Aug 20, 2021
Published by: Chulalongkorn University
In partnership with: Paradigm Publishing Services

© 2021 Dita Maria Virginia, Mae Sri Hartati Wahyuningsih, Dwi Aris Agung Nugrahaningsih, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution 4.0 License.