Table 1
Context sequence (VIC/FAM) rs2796498, rs9803799, and rs2746342
| SNP ID* | Context sequence (VIC/FAM dye) |
|---|---|
| rs2796498 | CTGTAACAGTGTTAGTGATTTAAAC[A/G] GAGAGAGCAACCTTACCCTTTCAGT |
| rs9803799 | TAAATACAGGGTTTATATCCCCACA[G/T] TCAATGTAAATTCCTTTTTTTAAAA |
| rs2746342 | AGAGAGGCTAAGATGCAGGCTGTAC[G/T] CTGGGTAGCCATGTACTCAGTTGTA |
Table 2
Baseline characteristics of the patients with T2DM
| Characteristics | (n = 166) |
|---|---|
| Age (years) | 54.0 ± 9.7 |
| Sex (female) | 117 (70.5) |
| Systolic blood pressure (mmHg) | 130.4 ± 18.7 |
| Diastolic blood pressure (mmHg) | 81.1 ± 8.7 |
| BMI (kg/m2) | 25.0 ± 4.0 |
| Waist circumference (cm) | 87.6 ± 9.2 |
| FPG (mg/dL) | 189.0 ± 71.2 |
| HbA1c (%) | 9.61 ± 2.32 |
| CrSr (mg/dL) | 0.89 ± 0.80 |
| eGFR (mL/min/1.73 m2) | 91.6 ± 26.7 |
[i] Continuous variables are presented as mean ± standard deviation, sex is presented as n (%).
[ii] BMI, body mass index; CrSr, serum creatinine; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; T2DM, type 2 diabetes mellitus.

Figure 1
Distribution of PRKAA2 genotype rs2796498, rs9803799, and rs2746342 in patients newly diagnosed with T2DM in Yogyakarta, Indonesia; PRKAA2 (NCBI gene ID: 5563), which encodes protein kinase adenosine monophosphate (AMP)-activated (EC 2.7.11.31) α2 catalytic subunit (AMPKα2); SNP, single nucleotide polymorphism; T2DM, type 2 diabetes mellitus.
Table 3
Clinical characteristics of patients with T2DM patients based on PRKAA2genetic variation
| Clinical Characteristic | rs2796498 (HWE 0.35) n (%) | P | rs9803799 (HWE 0.08) n (%) | P | rs2746342 (HWE 0.36) n (%) | P | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GG 95 (57.2) | AG 64 (38.6) | AA 7 (4.2) | TT 147 (88.6) | GT 17 (10.2) | GG 2 (1.2) | GG 55 (33.1) | GT 86 (51.8) | TT 25 (15.1) | ||||
| Age (years) | 53.3 ± 9.5 | 54.7 ± 10.2 | 55.7 ± 10.1 | 0.60 | 54.1 ± 9.6 | 53.7 ± 11.3 | 45.0 ± 2.8 | 0.42 | 54.3 ± 9.6 | 53.7 ± 9.8 | 54.0 ± 10.2 | 0.94 |
| BMI (kg/m2) | 24.95 ± 3.78 | 24.83 ± 4.20 | 27.14 ± 5.40 | 0.35 | 25.06 ± 4.03 | 24.53 ± 4.09 | 24.50 ± 3.54 | 0.87 | 24.60 ± 4.20 | 25.23 ± 3.69 | 25.09 ± 4.73 | 0.66 |
| WC (cm) | 87.4 ± 8.7 | 87.6 ± 10.1 | 91.0 ± 8.1 | 0.61 | 87.4 ± 9.5 | 90.1 ± 6.5 | 85.5 ± 3.5 | 0.49 | 86.6 ± 9.2 | 88.2 ± 9.6 | 88.0 ± 7.9 | 0.58 |
| SBP (mmHg) | 129.5 ± 19.1 | 131.3 ± 18.5 | 136.4 ± 15.0 | 0.57 | 131.1 ± 18.9 | 125.7 ± 14.8 | 124.0 ± 33.9 | 0.47 | 127.4 ± 19.7 | 131.8 ± 18.2 | 132.9 ± 17.7 | 0.31 |
| DBP (mmHg) | 81.2 ± 8.9 | 81.1 ± 8.5 | 80.4 ± 9.6 | 0.98 | 81.3 ± 8.2 | 79.6 ± 12.3 | 82.0 ± 17.0 | 0.74 | 80.0 ± 9.5 | 81.8 ± 8.6 | 81.3 ± 7.2 | 0.51 |
| FPG (mg/dL) | 188.8 ± 72.2 | 191.8 ± 70.8 | 167.9 ± 68.1 | 0.70 | 188.5 ± 70.0 | 195.5 ± 83.1 | 196.0 ± 103.2 | 0.97 | 186.5 ± 75.2 | 189.6 ± 68.8 | 192.7 ± 73.1 | 0.93 |
| HbA1c (%) | 9.65 ± 2.30 | 9.61 ± 2.35 | 8.97 ± 2.43 | 0.76 | 9.61 ± 2.25 | 9.66 ± 2.85 | 8.9 ± 3.40 | 0.91 | 9.42 ± 2.30 | 9.79 ± 2.32 | 9.39 ± 2.89 | 0.58 |
| CrSr (mg/dL) | 0.81 ± 0.49 | 1.04 ± 1.13 | 0.66 ± 0.10 | 0.48 | 0.87 ± 0.62 | 1.13 ± 1.75 | 0.67 ± 0.13 | 0.37 | 0.83 ± 0.52 | 0.97 ± 1.01 | 0.80 ± 0.33 | 0.48 |
| eGFR (mL/min) | 94.0 ± 24.7 | 87.5 ± 30.2 | 96.6 ± 13.1 | 0.66 | 91.5 ± 26.2 | 90.7 ± 32.6 | 111.5 ± 3.5 | 0.57 | 92.1 ± 24.6 | 90.9 ± 29.0 | 93.0 ± 23.7 | 0.93 |
[i] Data were analyzed using a one-way ANOVA or Kruskal–Wallis test, as appropriate.
[ii] BMI, body mass index; CrSr, serum creatinine; DBP, diastolic blood pressure; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; HWE, Hardy–Weinburg equilibrium; SBP, systolic blood pressure; T2DM, type 2 diabetes mellitus; WC, waist circumference.
Table 4
Association between PRKAA2 genetic variation and clinical characteristics of patients with T2DM
| Genotype | OR (95%CI) | |||||
|---|---|---|---|---|---|---|
| FPG | HbA1c | CrSr | eGFR | Blood pressure | Obesity status | |
| rs2796498 | ||||||
| GG | 1 (Reference) | |||||
| AG | 1.24 (0.66–2.34) | 0.90 (0.48–1.71) | 1.74 (0.86–3.51) | 2.51 (0.96–6.54) | 0.98 (0.51–1.92) | 1.18 (0.63–2.23) |
| AA | 0.99 (0.21–4.69) | 0.46 (0.09–2.51) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 1.41 (0.30–6.68) | 1.48 (0.31–6.98) |
| Dominant (GG vs. AG+AA) | 1.21 (0.65–1.26) | 0.85 (0.46–1.58) | 1.49 (0.75–2.98) | 2.21 (0.85–5.74) | 1.02 (0.54–1.95) | 1.21 (0.65–2.24) |
| Recessive (GG+AG vs. AA) | 0.91 (0.20–4.18) | 0.48 (0.09–2.57) | <0.01 (<0.01–NA) | <0.01 (<0.00–NA) | 1.42 (0.31–6.56) | 1.39 (0.30–6.39) |
| G allele | 1 (Reference) | |||||
| A allele | 1.13 (0.68–1.87) | 0.83 (0.50–1.38) | 1.19 (0.64–1.97) | 1.47 (0.71–3.04) | 1.06 (0.62–1.80) | 1.18 (0.71–1.96) |
| rs9803799 | ||||||
| TT | 1 (Reference) | |||||
| GT | 1.10 (0.40–2.98) | 0.86 (0.31–2.38) | 0.82 (0.25–2.67) | 1.64 (0.43–6.29) | 0.55 (0.17–1.76) | 0.90 (0.33–2.46) |
| GG | 1.23 (0.08–19.99) | 1.23 (0.08–19.99) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 1.77 (0.11–28.94) | 1.01 (0.06–16.51) |
| Dominant (TT vs. GT+GG) | 1.11 (0.42–2.88) | 0.89 (0.34–2.35) | 0.71 (0.22–2.28) | 1.43 (0.38–5.44) | 0.63 (0.22–1.86) | 0.91 (0.35–2.38) |
| Recessive (TT+GT vs. GG) | 1.22 (0.08–19.78) | 1.25 (0.08–20.27) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 1.88 (0.12–30.57) | 1.03 (0.06–16.66) |
| T allele | 1 (Reference) | |||||
| G allele | 1.11 (0.46–2.69) | 0.93 (0.38–2.27) | 0.64 (0.21–1.94) | 1.23 (0.35–4.39) | 0.73 (0.28–1.94) | 0.93 (0.38–2.24) |
| rs2746342 | ||||||
| GG | 1 (Reference) | |||||
| GT | 1.43 (0.72–2.84) | 1.55 (0.78–3.08) | 0.95 (0.43–2.06) | 2.48 (0.77–7.97) | 1.44 (0.70–2.99) | 1.90 (0.95–3.77) |
| TT | 1.18 (0.45–3.07) | 1.23 (0.49–3.32) | 1.65 (0.60–4.56) | 1.11 (0.19–6.49) | 1.63 (0.60–4.37) | 1.39 (0.53–3.59) |
| Dominant (GG vs. GT+TT) | 1.37 (0.71–2.64) | 1.48 (0.77–2.86) | 1.09 (0.52–2.27) | 2.15 (0.68–6.76) | 1.48 (0.74–2.98) | 1.77 (0.92–3.40) |
| Recessive (GG+GT vs. TT) | 0.95 (0.40–2.23) | 0.97 (0.41–2.29) | 1.70 (0.70–4.20) | 0.59 (0.13–6.16) | 1.29 (0.54–3.09) | 1.94 (0.40–2.19) |
| G allele | 1 (Reference) | |||||
| T allele | 1.14 (0.73–1.76) | 1.19 (0.76–1.84) | 1.21 (0.74–1.97) | 1.21 (0.62–2.35) | 1.28 (0.81–2.02) | 1.27 (0.82–1.97) |
[i] AMP, adenosine monophosphate; AMPKα2, AMP-activated protein kinase (EC 2.7.11.31) α2 catalytic subunit; CI, confidence interval; CrSr, serum creatinine; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; NA, not available; OR, odds ratio; PRKAA2 (NCBI gene ID: 5563), which encodes AMPKα2; T2DM, type 2 diabetes mellitus.
Table 5
Multiple regression logistic analysis adjusted for age and sex
| Genotype | OR (95%CI) | |||||
|---|---|---|---|---|---|---|
| FPG | HbA1c | CrSr | eGFR | Blood pressure | Obesity status | |
| rs2796498 | ||||||
| GG | 1 (Reference) | |||||
| AG | 1.27 (0.67–2.41) | 0.96 (0.50–1.85) | 1.79 (0.81–3.94) | 2.38 (0.87–6.50) | 0.95 (0.48–1.86) | 1.20 (0.64–2.28) |
| AA | 1.03 (0.22–4.89) | 0.44 (0.08–2.48) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 1.27 (0.26–6.14) | 1.49 (0.31–7.07) |
| Dominant (GG vs. AG+AA) | 1.24 (0.67–2.32) | 0.89 (0.47–1.69) | 1.51 (0.70–3.29) | 2.08 (0.77–5.67) | 0.98 (0.51–1.88) | 1.23 (0.66–2.28) |
| Recessive (GG+AG vs. AA) | 0.93 (0.20–4.34) | 0.45 (0.08–2.48) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 1.30 (0.28–6.13) | 1.38 (0.30–6.42) |
| G allele | 1 (Reference) | |||||
| A allele | 1.15 (0.69–1.92) | 0.85 (0.50–1.44) | 1.11 (0.59–2.09) | 1.34 (0.65–3.00) | 1.02 (0.59–1.74) | 1.19 (0.72–1.98) |
| rs9803799 | ||||||
| TT | 1 (Reference) | |||||
| GT | 1.08 (0.39–2.98) | 0.79 (0.27–2.27) | 0.86 (0.22–3.33) | 1.67 (0.39–7.14) | 0.54 (0.17–1.74) | 0.89 (0.32–2.44) |
| GG | 1.06 (0.06–17.61) | 1.07 (0.06–17.93) | <0.01 (<0.01–NA) | <0.01 (0.01–NA) | 2.52 (0.15–42.41) | 0.96 (0.06–15.95) |
| Dominant (TT vs. GT+GG) | 1.08 (0.41–2.83) | 0.81 (0.30–2.21) | 0.72 (0.19–2.70) | 1.53 (0.37–6.43) | 0.65 (0.22–1.91) | 0.90 (0.34–2.34) |
| Recessive (TT+GT vs. GG) | 1.05 (0.06–17.44) | 1.03 (0.06–18.30) | <0.01 (<0.01–NA) | <0.01 (0.01–NA) | 2.66 (0.16–44.71) | 0.97 (0.06–16.11) |
| T allele | 1 (Reference) | |||||
| G allele | 1.07 (0.44–2.61) | 0.71 (0.84–2.12) | 0.63 (0.18–2.22) | 1.38 (0.35–5.39) | 0.77 (0.29–2.06) | 0.91 (0.37–2.21) |
| rs2746342 | ||||||
| GG | 1 (Reference) | |||||
| GT | 1.42 (0.71–2.83) | 1.55 (0.76–3.14) | 0.99 (0.42–2.37) | 2.81 (0.83–9.51) | 1.48 (0.71–3.09) | 1.89 (0.95–3.76) |
| TT | 1.17 (0.45–3.06) | 1.30 (0.48–3.47) | 1.88 (0.59–5.95) | 1.04 (0.16–6.65) | 1.67 (0.61–4.54) | 1.39 (0.54–3.60) |
| Dominant (GG vs. GT+TT) | 1.36 (0.71–2.63) | 1.49 (0.75–2.93) | 1.16 (0.51–2.63) | 2.34 (0.71–7.71) | 1.52 (0.75–3.07) | 1.76 (0.91–3.40) |
| Recessive (GG+GT vs. TT) | 0.95 (0.40–2.23) | 0.99 (0.41–2.40) | 1.89 (0.68–5.26) | 0.52 (0.10–2.62) | 1.31 (0.54–3.16) | 0.94 (0.40–2.21) |
| G allele | 1 (Reference) | |||||
| T allele | 1.13 (0.73–1.76) | 1.20 (0.76–1.87) | 1.28 (0.73–2.21) | 1.22 (0.61–2.45) | 1.03 (0.82–2.06) | 1.27 (0.82–1.97) |
[i] CI, confidence interval; CrSr, serum creatinine; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; NA, not available; OR, odds ratio.
Table 6
Multiple regression logistic analysis adjusted for age, sex, and waist circumference
| Genotype | OR (95%CI) | |||||
|---|---|---|---|---|---|---|
| FPG | HbA1c | CrSr | eGFR | Blood pressure | Obesity status | |
| rs2796498 | ||||||
| GG | 1 (Reference) | |||||
| AG | 1.29 (0.67–2.45) | 0.97 (0.50–1.87) | 1.79 (0.81–3.96) | 2.38 (0.87–6.49) | 0.92 (0.46–1.84) | 1.31 (0.60–2.87) |
| AA | 1.14 (0.24–5.46) | 0.48 (0.09–2.71) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 1.08 (0.22–5.25) | 0.89 (0.14–5.49) |
| Dominant (GG vs. AG+AA) | 1.27 (0.68–2.38) | 0.91 (0.48–1.72) | 1.51 (0.70–3.29) | 2.09 (0.77–5.68) | 0.94 (0.48–1.83) | 1.26 (0.59–2.67) |
| Recessive (GG+AG vs. AA) | 1.03 (0.22–4.81) | 0.49 (0.09–2.69) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 1.11 (0.23–5.29) | 0.80 (0.13–4.84) |
| G allele | 1 (Reference) | |||||
| A allele | 1.18 (0.70–1.97) | 0.87 (0.51–1.47) | 1.11 (0.59–2.09) | 1.40 (0.65–3.03) | 0.97 (0.56–1.68) | 1.14 (0.61–2.13) |
| rs9803799 | ||||||
| TT | 1 (Reference) | |||||
| GT | 1.17 (0.42–3.24) | 0.83 (0.29–2.43) | 0.84 (0.22–3.31) | 1.82 (0.42–7.92) | 0.45 (0.14–1.51) | 0.50 (0.15–1.62) |
| GG | 0.99 (0.06–16.53) | 0.95 (0.05–16.76) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 3.06 (0.18–52.68) | 1.38 (0.07–26.18) |
| Dominant (TT vs. GT+GG) | 1.15 (0.43–3.03) | 0.85 (0.31–2.33) | 0.71 (0.19–2.68) | 1.64 (0.39–6.99) | 0.57 (0.19–1.72) | 0.57 (0.19–1.72) |
| Recessive (TT+GT vs. GG) | 0.98 (0.06–16.27) | 0.97 (0.06–17.00) | <0.01 (<0.01–NA) | <0.01 (<0.01–NA) | 3.24 (0.19–55.53) | 1.46 (0.08–27.28) |
| T allele | 1 (Reference) | |||||
| G allele | 1.12 (0.46–2.74) | 0.87 (0.34–2.19) | 0.62 (0.18–2.20) | 1.45 (0.37–5.68) | 0.71 (0.26–1.92) | 0.65 (0.24–1.78) |
| rs2746342 | ||||||
| GG | 1 (Reference) | |||||
| GT | 1.49 (0.75–2.99) | 1.63 (0.79–3.34) | 0.99 (0.41–2.36) | 2.87 (0.85–9.72) | 1.39 (0.66–2.95) | 1.94 (0.84–4.49) |
| TT | 1.23 (0.47–3.22) | 1.35 (0.50–3.66) | 1.87 (0.59–5.93) | 1.05 (0.16–6.77) | 1.60 (0.58–4.43) | 1.33 (0.43–4.11) |
| Dominant (GG vs. GT+TT) | 1.43 (0.73–2.78) | 1.56 (0.79–3.11) | 1.15 (0.50–2.63) | 2.39 (0.72–7.87) | 1.44 (0.70–2.95) | 1.77 (0.80–3.92) |
| Recessive (GG+GT vs. TT) | 0.96 (0.40–2.27) | 0.99 (0.41–2.42) | 1.89 (0.68–5.25) | 0.52 (0.10–2.63) | 1.30 (0.53–3.20) | 0.89 (0.33–2.44) |
| G allele | 1 (Reference) | |||||
| T allele | 1.16 (0.74–1.81) | 1.22 (0.77–1.93) | 1.27 (0.73–2.21) | 1.23 (0.61–2.48) | 1.26 (0.79–2.02) | 1.25 (0.74–2.13) |
[i] P < 0.05 is considered significant.
[ii] CI, confidence interval; CrSr, serum creatinine; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, hemoglobin A1c; NA, not available; OR, odds ratio; WC, waist circumference.