Have a personal or library account? Click to login
PRKAA2 variation and the clinical characteristics of patients newly diagnosed with type 2 diabetes mellitus in Yogyakarta, Indonesia Cover

PRKAA2 variation and the clinical characteristics of patients newly diagnosed with type 2 diabetes mellitus in Yogyakarta, Indonesia

Asian Biomedicine
Volume 15 (2021): Issue 4 (August 2021)
By: Dita Maria Virginia,  Mae Sri Hartati Wahyuningsih and  Dwi Aris Agung Nugrahaningsih  
Open Access
|Aug 2021

Figures & Tables

Figure 1

Distribution of PRKAA2 genotype rs2796498, rs9803799, and rs2746342 in patients newly diagnosed with T2DM in Yogyakarta, Indonesia; PRKAA2 (NCBI gene ID: 5563), which encodes protein kinase adenosine monophosphate (AMP)-activated (EC 2.7.11.31) α2 catalytic subunit (AMPKα2); SNP, single nucleotide polymorphism; T2DM, type 2 diabetes mellitus.
Distribution of PRKAA2 genotype rs2796498, rs9803799, and rs2746342 in patients newly diagnosed with T2DM in Yogyakarta, Indonesia; PRKAA2 (NCBI gene ID: 5563), which encodes protein kinase adenosine monophosphate (AMP)-activated (EC 2.7.11.31) α2 catalytic subunit (AMPKα2); SNP, single nucleotide polymorphism; T2DM, type 2 diabetes mellitus.

Clinical characteristics of patients with T2DM patients based on PRKAA2genetic variation

Clinical Characteristicrs2796498 (HWE 0.35)n (%)Prs9803799 (HWE 0.08)n (%)Prs2746342 (HWE 0.36)n (%)P
GG 95 (57.2)AG 64 (38.6)AA 7 (4.2)TT 147 (88.6)GT 17 (10.2)GG 2 (1.2)GG 55 (33.1)GT 86 (51.8)TT 25 (15.1)
Age (years)53.3 ± 9.554.7 ± 10.255.7 ± 10.10.6054.1 ± 9.653.7 ± 11.345.0 ± 2.80.4254.3 ± 9.653.7 ± 9.854.0 ± 10.20.94
BMI (kg/m2)24.95 ± 3.7824.83 ± 4.2027.14 ± 5.400.3525.06 ± 4.0324.53 ± 4.0924.50 ± 3.540.8724.60 ± 4.2025.23 ± 3.6925.09 ± 4.730.66
WC (cm)87.4 ± 8.787.6 ± 10.191.0 ± 8.10.6187.4 ± 9.590.1 ± 6.585.5 ± 3.50.4986.6 ± 9.288.2 ± 9.688.0 ± 7.90.58
SBP (mmHg)129.5 ± 19.1131.3 ± 18.5136.4 ± 15.00.57131.1 ± 18.9125.7 ± 14.8124.0 ± 33.90.47127.4 ± 19.7131.8 ± 18.2132.9 ± 17.70.31
DBP (mmHg)81.2 ± 8.981.1 ± 8.580.4 ± 9.60.9881.3 ± 8.279.6 ± 12.382.0 ± 17.00.7480.0 ± 9.581.8 ± 8.681.3 ± 7.20.51
FPG (mg/dL)188.8 ± 72.2191.8 ± 70.8167.9 ± 68.10.70188.5 ± 70.0195.5 ± 83.1196.0 ± 103.20.97186.5 ± 75.2189.6 ± 68.8192.7 ± 73.10.93
HbA1c (%)9.65 ± 2.309.61 ± 2.358.97 ± 2.430.769.61 ± 2.259.66 ± 2.858.9 ± 3.400.919.42 ± 2.309.79 ± 2.329.39 ± 2.890.58
CrSr (mg/dL)0.81 ± 0.491.04 ± 1.130.66 ± 0.100.480.87 ± 0.621.13 ± 1.750.67 ± 0.130.370.83 ± 0.520.97 ± 1.010.80 ± 0.330.48
eGFR (mL/min)94.0 ± 24.787.5 ± 30.296.6 ± 13.10.6691.5 ± 26.290.7 ± 32.6111.5 ± 3.50.5792.1 ± 24.690.9 ± 29.093.0 ± 23.70.93

Multiple regression logistic analysis adjusted for age, sex, and waist circumference

GenotypeOR (95%CI)
FPGHbA1cCrSreGFRBlood pressureObesity status
rs2796498
GG1 (Reference)
AG1.29 (0.67–2.45)0.97 (0.50–1.87)1.79 (0.81–3.96)2.38 (0.87–6.49)0.92 (0.46–1.84)1.31 (0.60–2.87)
AA1.14 (0.24–5.46)0.48 (0.09–2.71)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.08 (0.22–5.25)0.89 (0.14–5.49)
Dominant (GG vs. AG+AA)1.27 (0.68–2.38)0.91 (0.48–1.72)1.51 (0.70–3.29)2.09 (0.77–5.68)0.94 (0.48–1.83)1.26 (0.59–2.67)
Recessive (GG+AG vs. AA)1.03 (0.22–4.81)0.49 (0.09–2.69)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.11 (0.23–5.29)0.80 (0.13–4.84)
G allele1 (Reference)
A allele1.18 (0.70–1.97)0.87 (0.51–1.47)1.11 (0.59–2.09)1.40 (0.65–3.03)0.97 (0.56–1.68)1.14 (0.61–2.13)
rs9803799
TT1 (Reference)
GT1.17 (0.42–3.24)0.83 (0.29–2.43)0.84 (0.22–3.31)1.82 (0.42–7.92)0.45 (0.14–1.51)0.50 (0.15–1.62)
GG0.99 (0.06–16.53)0.95 (0.05–16.76)<0.01 (<0.01–NA)<0.01 (<0.01–NA)3.06 (0.18–52.68)1.38 (0.07–26.18)
Dominant (TT vs. GT+GG)1.15 (0.43–3.03)0.85 (0.31–2.33)0.71 (0.19–2.68)1.64 (0.39–6.99)0.57 (0.19–1.72)0.57 (0.19–1.72)
Recessive (TT+GT vs. GG)0.98 (0.06–16.27)0.97 (0.06–17.00)<0.01 (<0.01–NA)<0.01 (<0.01–NA)3.24 (0.19–55.53)1.46 (0.08–27.28)
T allele1 (Reference)
G allele1.12 (0.46–2.74)0.87 (0.34–2.19)0.62 (0.18–2.20)1.45 (0.37–5.68)0.71 (0.26–1.92)0.65 (0.24–1.78)
rs2746342
GG1 (Reference)
GT1.49 (0.75–2.99)1.63 (0.79–3.34)0.99 (0.41–2.36)2.87 (0.85–9.72)1.39 (0.66–2.95)1.94 (0.84–4.49)
TT1.23 (0.47–3.22)1.35 (0.50–3.66)1.87 (0.59–5.93)1.05 (0.16–6.77)1.60 (0.58–4.43)1.33 (0.43–4.11)
Dominant (GG vs. GT+TT)1.43 (0.73–2.78)1.56 (0.79–3.11)1.15 (0.50–2.63)2.39 (0.72–7.87)1.44 (0.70–2.95)1.77 (0.80–3.92)
Recessive (GG+GT vs. TT)0.96 (0.40–2.27)0.99 (0.41–2.42)1.89 (0.68–5.25)0.52 (0.10–2.63)1.30 (0.53–3.20)0.89 (0.33–2.44)
G allele1 (Reference)
T allele1.16 (0.74–1.81)1.22 (0.77–1.93)1.27 (0.73–2.21)1.23 (0.61–2.48)1.26 (0.79–2.02)1.25 (0.74–2.13)

Multiple regression logistic analysis adjusted for age and sex

GenotypeOR (95%CI)
FPGHbA1cCrSreGFRBlood pressureObesity status
rs2796498
GG1 (Reference)
AG1.27 (0.67–2.41)0.96 (0.50–1.85)1.79 (0.81–3.94)2.38 (0.87–6.50)0.95 (0.48–1.86)1.20 (0.64–2.28)
AA1.03 (0.22–4.89)0.44 (0.08–2.48)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.27 (0.26–6.14)1.49 (0.31–7.07)
Dominant (GG vs. AG+AA)1.24 (0.67–2.32)0.89 (0.47–1.69)1.51 (0.70–3.29)2.08 (0.77–5.67)0.98 (0.51–1.88)1.23 (0.66–2.28)
Recessive (GG+AG vs. AA)0.93 (0.20–4.34)0.45 (0.08–2.48)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.30 (0.28–6.13)1.38 (0.30–6.42)
G allele1 (Reference)
A allele1.15 (0.69–1.92)0.85 (0.50–1.44)1.11 (0.59–2.09)1.34 (0.65–3.00)1.02 (0.59–1.74)1.19 (0.72–1.98)
rs9803799
TT1 (Reference)
GT1.08 (0.39–2.98)0.79 (0.27–2.27)0.86 (0.22–3.33)1.67 (0.39–7.14)0.54 (0.17–1.74)0.89 (0.32–2.44)
GG1.06 (0.06–17.61)1.07 (0.06–17.93)<0.01 (<0.01–NA)<0.01 (0.01–NA)2.52 (0.15–42.41)0.96 (0.06–15.95)
Dominant (TT vs. GT+GG)1.08 (0.41–2.83)0.81 (0.30–2.21)0.72 (0.19–2.70)1.53 (0.37–6.43)0.65 (0.22–1.91)0.90 (0.34–2.34)
Recessive (TT+GT vs. GG)1.05 (0.06–17.44)1.03 (0.06–18.30)<0.01 (<0.01–NA)<0.01 (0.01–NA)2.66 (0.16–44.71)0.97 (0.06–16.11)
T allele1 (Reference)
G allele1.07 (0.44–2.61)0.71 (0.84–2.12)0.63 (0.18–2.22)1.38 (0.35–5.39)0.77 (0.29–2.06)0.91 (0.37–2.21)
rs2746342
GG1 (Reference)
GT1.42 (0.71–2.83)1.55 (0.76–3.14)0.99 (0.42–2.37)2.81 (0.83–9.51)1.48 (0.71–3.09)1.89 (0.95–3.76)
TT1.17 (0.45–3.06)1.30 (0.48–3.47)1.88 (0.59–5.95)1.04 (0.16–6.65)1.67 (0.61–4.54)1.39 (0.54–3.60)
Dominant (GG vs. GT+TT)1.36 (0.71–2.63)1.49 (0.75–2.93)1.16 (0.51–2.63)2.34 (0.71–7.71)1.52 (0.75–3.07)1.76 (0.91–3.40)
Recessive (GG+GT vs. TT)0.95 (0.40–2.23)0.99 (0.41–2.40)1.89 (0.68–5.26)0.52 (0.10–2.62)1.31 (0.54–3.16)0.94 (0.40–2.21)
G allele1 (Reference)
T allele1.13 (0.73–1.76)1.20 (0.76–1.87)1.28 (0.73–2.21)1.22 (0.61–2.45)1.03 (0.82–2.06)1.27 (0.82–1.97)

Baseline characteristics of the patients with T2DM

Characteristics(n = 166)
Age (years)54.0 ± 9.7
Sex (female)117 (70.5)
Systolic blood pressure (mmHg)130.4 ± 18.7
Diastolic blood pressure (mmHg)81.1 ± 8.7
BMI (kg/m2)25.0 ± 4.0
Waist circumference (cm)87.6 ± 9.2
FPG (mg/dL)189.0 ± 71.2
HbA1c (%)9.61 ± 2.32
CrSr (mg/dL)0.89 ± 0.80
eGFR (mL/min/1.73 m2)91.6 ± 26.7

Association between PRKAA2 genetic variation and clinical characteristics of patients with T2DM

GenotypeOR (95%CI)
FPGHbA1cCrSreGFRBlood pressureObesity status
rs2796498
GG1 (Reference)
AG1.24 (0.66–2.34)0.90 (0.48–1.71)1.74 (0.86–3.51)2.51 (0.96–6.54)0.98 (0.51–1.92)1.18 (0.63–2.23)
AA0.99 (0.21–4.69)0.46 (0.09–2.51)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.41 (0.30–6.68)1.48 (0.31–6.98)
Dominant (GG vs. AG+AA)1.21 (0.65–1.26)0.85 (0.46–1.58)1.49 (0.75–2.98)2.21 (0.85–5.74)1.02 (0.54–1.95)1.21 (0.65–2.24)
Recessive (GG+AG vs. AA)0.91 (0.20–4.18)0.48 (0.09–2.57)<0.01 (<0.01–NA)<0.01 (<0.00–NA)1.42 (0.31–6.56)1.39 (0.30–6.39)
G allele1 (Reference)
A allele1.13 (0.68–1.87)0.83 (0.50–1.38)1.19 (0.64–1.97)1.47 (0.71–3.04)1.06 (0.62–1.80)1.18 (0.71–1.96)
rs9803799
TT1 (Reference)
GT1.10 (0.40–2.98)0.86 (0.31–2.38)0.82 (0.25–2.67)1.64 (0.43–6.29)0.55 (0.17–1.76)0.90 (0.33–2.46)
GG1.23 (0.08–19.99)1.23 (0.08–19.99)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.77 (0.11–28.94)1.01 (0.06–16.51)
Dominant (TT vs. GT+GG)1.11 (0.42–2.88)0.89 (0.34–2.35)0.71 (0.22–2.28)1.43 (0.38–5.44)0.63 (0.22–1.86)0.91 (0.35–2.38)
Recessive (TT+GT vs. GG)1.22 (0.08–19.78)1.25 (0.08–20.27)<0.01 (<0.01–NA)<0.01 (<0.01–NA)1.88 (0.12–30.57)1.03 (0.06–16.66)
T allele1 (Reference)
G allele1.11 (0.46–2.69)0.93 (0.38–2.27)0.64 (0.21–1.94)1.23 (0.35–4.39)0.73 (0.28–1.94)0.93 (0.38–2.24)
rs2746342
GG1 (Reference)
GT1.43 (0.72–2.84)1.55 (0.78–3.08)0.95 (0.43–2.06)2.48 (0.77–7.97)1.44 (0.70–2.99)1.90 (0.95–3.77)
TT1.18 (0.45–3.07)1.23 (0.49–3.32)1.65 (0.60–4.56)1.11 (0.19–6.49)1.63 (0.60–4.37)1.39 (0.53–3.59)
Dominant (GG vs. GT+TT)1.37 (0.71–2.64)1.48 (0.77–2.86)1.09 (0.52–2.27)2.15 (0.68–6.76)1.48 (0.74–2.98)1.77 (0.92–3.40)
Recessive (GG+GT vs. TT)0.95 (0.40–2.23)0.97 (0.41–2.29)1.70 (0.70–4.20)0.59 (0.13–6.16)1.29 (0.54–3.09)1.94 (0.40–2.19)
G allele1 (Reference)
T allele1.14 (0.73–1.76)1.19 (0.76–1.84)1.21 (0.74–1.97)1.21 (0.62–2.35)1.28 (0.81–2.02)1.27 (0.82–1.97)

Context sequence (VIC/FAM) rs2796498, rs9803799, and rs2746342

SNP ID*Context sequence (VIC/FAM dye)
rs2796498CTGTAACAGTGTTAGTGATTTAAAC[A/G]GAGAGAGCAACCTTACCCTTTCAGT
rs9803799TAAATACAGGGTTTATATCCCCACA[G/T]TCAATGTAAATTCCTTTTTTTAAAA
rs2746342AGAGAGGCTAAGATGCAGGCTGTAC[G/T]CTGGGTAGCCATGTACTCAGTTGTA
DOI: https://doi.org/10.2478/abm-2021-0021 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415
Journal RSS Feed
Language: English
Page range: 161 - 170
Published on: Aug 20, 2021
Published by: Chulalongkorn University
In partnership with: Paradigm Publishing Services
Publication frequency: 6 issues per year
Keywords:
genetic variation,
Indonesia,
type 2 diabetes mellitus
Related subjects:
Medicine,
Assistive professions, nursing,
Basic medical science,
Basic medical science, other,
Clinical medicine,
Clinical medicine, other

© 2021 Dita Maria Virginia, Mae Sri Hartati Wahyuningsih, Dwi Aris Agung Nugrahaningsih, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous articleVolume 15 (2021): Issue 4 (August 2021)Next article