Fig. 1.
Fig. 2.
Fig. 3.
Fig. 4.
Fig. 5.
Fig. 6.
PKS and NRPS genes in endophytic bacteria isolated from Paeonia ostii_
| Gene | No. of isolates | Amino acid residues | Accession number | Top BLASTP match (GenBank accession No.) | Identity (%) | Predicted binding pocket (amino acid substrate) |
|---|---|---|---|---|---|---|
| PKS | Md1-2 | 226 | MF589505 | polyketide synthase, Nostoc sp. (AGJ72843) | 144/226(64%) | Not done |
| PKS | Md1-4 | 227 | MF589506 | polyketide synthase, Bacillus sp. (ACG70843) | 226/227(99%) | Not done |
| PKS | Md1-6 | 227 | MF589507 | type I ketosynthase, Bacillus sp. (AIO09656) | 220/224(98%) | Not done |
| PKS | Md1-9 | 224 | MF589508 | type I ketosynthase, Bacillus sp. (AIO09656) | 220/222(99%) | Not done |
| PKS | Md1-21 | 223 | MF589509 | type I ketosynthase, Bacillus sp. (AIO09652) | 222/222(100%) | Not done |
| PKS | Md1-24 | 227 | MF589510 | polyketide synthase, Bacillus sp. (ACG70842) | 224/227(99%) | Not done |
| PKS | Md1-37 | 227 | MF589511 | polyketide synthase, Bacillus sp. (ACG70841) | 226/227(99%) | Not done |
| PKS | Md1-41 | 227 | MF589512 | polyketide synthase, Bacillus sp. (ACG70841) | 226/227(99%) | Not done |
| PKS | Md1-43 | 226 | MF589513 | type I ketosynthase, Bacillus sp. (AIO09656) | 219/224(98%)) | Not done |
| PKS | Md1-44 | 224 | MF589514 | type I ketosynthase, Bacillus sp. (AIO09656) | 218/222(98%) | Not done |
| PKS | Md1-45 | 229 | MF589515 | polyketide synthase, Bacillus sp. (ACG70842) | 226/229(99%)) | Not done |
| PKS | Md1-50 | 227 | MF589516 | polyketide synthase, Bacillus sp. (ACG70843) | 227/227(100%) | Not done |
| PKS | Md1-51 | 223 | MF589517 | type I ketosynthase, Bacillus sp. (AIO09656) | 221/222(99%) | Not done |
| NRPS | Md1-2 | 232 | MF589518 | non-ribosomal peptide synthetase, Streptomyces hiroshimensis(BAH68742) | 158/217(73%) | DFECLSVVT-(Val) |
| NRPS | Md1-18 | 232 | MF589519 | non-ribosomal peptide synthetase, Streptomyces hiroshimensis (BAH68742) | 158/217(73%) | DFECLSVVT-(Val) |
| NRPS | Md1-24 | 252 | MF589520 | nonribosomal peptide synthase, Bacillus sp. (KIA75709) | 249/252(99%) | DAKDLGVVD-(Glu) |
| NRPS | Md1-47 | 233 | MF589521 | non-ribosomal peptide synthetase, Pseudomonas sp. (WP_085703687) | 225/233(97%) | DAWVFGVVI-(Glu) |
| NRPS | Md1-50 | 245 | MF589522 | non-ribosomal peptide synthetase, Bacillus velezensis (WP_069007535) | 243/245(99%) | DFWNIGMVH-(Thr) |
PKS and NRPS genes in endophytic fungi isolated from Paeonia ostii_
| Gene | No. of isolates | Amino acid residues | Accession number | Top BLASTP match (GenBank accession No.) | Identity (%) | Predicted binding pocket (amino acid substrate) |
|---|---|---|---|---|---|---|
| PKS | Mdf-4 | 250 | MF680559 | related to fusarin C cluster-polyketide synthase/NRPS, Rhynchosporium agropyri (CZS94917) | 222/250(89%) | Not done |
| PKS | Mdf-15 | 238 | MF680560 | ketoacyl-synt-domain-containing protein, Coniochaeta ligniaria (OIW26903) | 201/240(84%) | Not done |
| PKS | Mdf-17 | 211 | MF680561 | beta-ketoacyl synthase domain-containing protein, Metarhizium album (KHO00577) | 201/240(84%) | Not done |
| PKS | Mdf-26 | 231 | MF680562 | PKS protein, Trichoderma parareesei (OTA00034) | 175/231(76%) | Not done |
| PKS | Mdf-41 | 234 | MF680563 | polyketide synthase PksF, Alternaria alternata (XP_018382155) | 233/234(90%) | Not done |
| PKS | Mdf-43 | 238 | MF680564 | ketoacyl-synt-domain-containing protein, Coniochaeta ligniaria (OIW26903) | 227/234(97%) | Not done |
| PKS | Mdf-44 | 234 | MF680565 | polyketide synthase PksF, Alternaria alternata (XP_018382155) | 131/217(60%) | Not done |
| PKS | Mdf-47 | 250 | MF680566 | related to fusarin C cluster-polyketide synthase/NRPS, Rhynchosporium agropyri (CZS94917) | 233/234(99%) | Not done |
| PKS | Mdf-49 | 234 | MF680567 | polyketide synthase PksF, Alternaria alternata (XP_018382155) | 233/234(99%) | Not done |
| PKS | Mdf-51 | 234 | MF680568 | polyketide synthase PksF, Alternaria alternata (AFN68297) | 233/234(99%) | Not done |
| NRPS | Mdf-2 | 244 | MF680550 | acetyl-CoA synthetase-like protein, Stagonospora sp. (OAK98265) | 218/244(89%) | No prediction |
| NRPS | Mdf-6 | 234 | MF680551 | nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793) | 195/235(83%) | DIGFVGGIF-(Ile) |
| NRPS | Mdf-8 | 231 | MF680552 | nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793) | 208/231(90%) | DVTLVGCVV-(Cys) |
| NRPS | Mdf-9 | 222 | MF680553 | nonribosomal peptide synthetase, Cenococcum geophilum (OCK98900) | 195/222(88%) | DVAFIGSIH-(Phe) |
| NRPS | Mdf-18 | 228 | MF680554 | nonribosomal peptide synthetase, Cenococcum geophilum (OCK98900) | 198/228(87%) | DVAFIGSIH-(Phe) |
| NRPS | Mdf-20 | 246 | MF680555 | acetyl-CoA synthetase-like protein, Stagonospora sp. (OAK98265) | 223/246(91%) | No prediction |
| NRPS | Mdf-22 | 238 | MF680556 | nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793) | 220/237(93%) | DAMLVGAVI-(Gln) |
| NRPS | Mdf-41 | 240 | MF680557 | nonribosomal peptide synthase, Alternaria alternata (XP_018382376) | 201/240(84%) | DAILVGAVV-(Gln) |
| NRPS | Mdf-50 | 238 | MF680558 | nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793) | 217/237(92%) | DAMLVGAVI-(Gln) |
PCR primers for identification and screening the biosynthetic genes of endophytic isolates_
| Primer name | Primer Sequence (5’-3’) | Target gene | Product size (bp) | References |
|---|---|---|---|---|
| 24F | AGAGTTTGATC(A/C)TGGCTCAG | 16S rDNA | 1400–1500 | Heuer et al. 1997 |
| 1492R | TACGG(C/T)TACCTTGTTACGACTT | |||
| ITS1 | TCCGTAGGTGAACCTGCGG | ITS | 500 | White et al. 1990 |
| ITS4 | TCCTCCGCTTATTGATATGC | |||
| KSαF | TSGCSTGCTTGGAYGCSATC | Bacterial PKS | 600–700 | Metsä-Ketalä et al. 1999 |
| KSαR | TGGAANCCGCCGAABCCGCT | |||
| A3F | GCSTACSYSATSTACACSTCSGG | Bacterial NRPS | 700 | Ayuso-Sacido and Genilloud 2005 |
| A7R | SASGTCVCCSGTSGCG TAS | |||
| KAF1 | GARKSICAYGGIACIGGIAC | Fungal PKS | 700–800 | Amnuaykanjanasin et al. 2005 |
| KAR1 | CCAYTGIGCICCRTGICCIGARAA | |||
| AUG003 | CCGGCACCACCGGNAARCCHAA | Fungal NRPS | 600–700 | Slightom et al. 2009 |
| AUG007 | CCGGACCATGTCGCCNGTBYKRTA |
The distribution of endophytic bacteria and fungi within Paeonia ostii_
| Genera | No. of isolates | Relative abundance (%) |
|---|---|---|
| Endophytic bacteria | ||
| Streptomyces | Md1-1, Md1-2, Md1-3, Md1-18 | 7.1 |
| Promicromonosporaceae | Md1-20 | 1.8 |
| Microbacterium | Md1-5, Md1-29 | 3.6 |
| Citricoccus | Md1-48 | 1.8 |
| Bacillus | Md1-4, Md1-6, Md1-8, Md1-9, Md1-10, Md1-11, Md1-12, Md1-13, Md1-15, Md1-16, Md1-17, Md1-19, Md1-21, Md1-22, Md1-24, Md1-25, Md1-26, Md1-31, Md1-33, Md1-35, Md1-36, Md1-39, Md1-37, Md1-41, Md1-42, Md1-43, Md1-44, Md1-45, Md1-46, Md1-50, Md1-51 | 55.4 |
| Psychrobacillus | Md1-27 | 1.8 |
| Lysinibacillus | Md1-14, Md1-30 | 3.6 |
| Planococcus | Md1-49 | 1.8 |
| Xanthomonas | Md1-23, Md1-28 | 3.6 |
| Pseudomonas | Md1-34 | 1.8 |
| Serratia | Md1-32, Md1-47 | 3.6 |
| Enterobacter | Md1-38, Md1-40, Md1-52, Md1-53, Md1-56 | 8.9 |
| Lelliottia | Md1-7, Md1-54, Md1-55 | 5.4 |
| Endophytic fungi | ||
| Cylindrocarpon | Mdf-3, Mdf-10, Mdf-13, Mdf-15, Mdf-36, Mdf-38, Mdf-43, Mdf-47 | 15.7 |
| Fusarium | Mdf-5, Mdf-6, Mdf-7, Mdf-8, Mdf-11, Mdf-18, Mdf-22, Mdf-23, Mdf-25, Mdf-28 | 19.6 |
| unclassified Nectriaceae | Mdf-26 | 2.0 |
| Thelonectria | Mdf-1, Mdf-17 | 4.0 |
| Cephalosporium | Mdf-4, Mdf-48 | 4.0 |
| Leptosphaeria | Mdf-2, Mdf-9, Mdf-12, Mdf-16, Mdf-20, Mdf-29, Mdf-33, Mdf-34, Mdf-37, Mdf-40, Mdf-46 | 21.6 |
| Alternaria | Mdf-27, Mdf-30, Mdf-31, Mdf-32, Mdf-39, Mdf-41, Mdf-42, Mdf-44, Mdf-45, Mdf-49, Mdf-50, Mdf-51 | 23.5 |
| Acrocalymma | Mdf-35 | 2.0 |
| Cladosporium | Mdf-14 | 2.0 |
| Macrophomina | Mdf-19 | 2.0 |
| Phomopsis | Mdf-24 | 2.0 |
| Mucor | Mdf-21 | 2.0 |