Table I
PCR primers for identification and screening the biosynthetic genes of endophytic isolates.
| Primer name | Primer Sequence (5’-3’) | Target gene | Product size (bp) | References |
|---|---|---|---|---|
| 24F | AGAGTTTGATC(A/C)TGGCTCAG | 16S rDNA | 1400–1500 | Heuer et al. 1997 |
| 1492R | TACGG(C/T)TACCTTGTTACGACTT | |||
| ITS1 | TCCGTAGGTGAACCTGCGG | ITS | 500 | White et al. 1990 |
| ITS4 | TCCTCCGCTTATTGATATGC | |||
| KSαF | TSGCSTGCTTGGAYGCSATC | Bacterial PKS | 600–700 | Metsä-Ketalä et al. 1999 |
| KSαR | TGGAANCCGCCGAABCCGCT | |||
| A3F | GCSTACSYSATSTACACSTCSGG | Bacterial NRPS | 700 | Ayuso-Sacido and Genilloud 2005 |
| A7R | SASGTCVCCSGTSGCG TAS | |||
| KAF1 | GARKSICAYGGIACIGGIAC | Fungal PKS | 700–800 | Amnuaykanjanasin et al. 2005 |
| KAR1 | CCAYTGIGCICCRTGICCIGARAA | |||
| AUG003 | CCGGCACCACCGGNAARCCHAA | Fungal NRPS | 600–700 | Slightom et al. 2009 |
| AUG007 | CCGGACCATGTCGCCNGTBYKRTA |
Fig. 1.
Phylogenetic relationship of isolated bacterial endophytes and reference bacteria based on 16S rRNA gene sequences. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The GenBank accession numbers of 16S rRNA sequences are given in the parentheses. The scale bar represents 0.02 nucleotide changes.
Table II
The distribution of endophytic bacteria and fungi within Paeonia ostii.
| Genera | No. of isolates | Relative abundance (%) |
|---|---|---|
| Endophytic bacteria | ||
| Streptomyces | Md1-1, Md1-2, Md1-3, Md1-18 | 7.1 |
| Promicromonosporaceae | Md1-20 | 1.8 |
| Microbacterium | Md1-5, Md1-29 | 3.6 |
| Citricoccus | Md1-48 | 1.8 |
| Bacillus | Md1-4, Md1-6, Md1-8, Md1-9, Md1-10, Md1-11, Md1-12, Md1-13, Md1-15, Md1-16, Md1-17, Md1-19, Md1-21, Md1-22, Md1-24, Md1-25, Md1-26, Md1-31, Md1-33, Md1-35, Md1-36, Md1-39, Md1-37, Md1-41, Md1-42, Md1-43, Md1-44, Md1-45, Md1-46, Md1-50, Md1-51 | 55.4 |
| Psychrobacillus | Md1-27 | 1.8 |
| Lysinibacillus | Md1-14, Md1-30 | 3.6 |
| Planococcus | Md1-49 | 1.8 |
| Xanthomonas | Md1-23, Md1-28 | 3.6 |
| Pseudomonas | Md1-34 | 1.8 |
| Serratia | Md1-32, Md1-47 | 3.6 |
| Enterobacter | Md1-38, Md1-40, Md1-52, Md1-53, Md1-56 | 8.9 |
| Lelliottia | Md1-7, Md1-54, Md1-55 | 5.4 |
| Endophytic fungi | ||
| Cylindrocarpon | Mdf-3, Mdf-10, Mdf-13, Mdf-15, Mdf-36, Mdf-38, Mdf-43, Mdf-47 | 15.7 |
| Fusarium | Mdf-5, Mdf-6, Mdf-7, Mdf-8, Mdf-11, Mdf-18, Mdf-22, Mdf-23, Mdf-25, Mdf-28 | 19.6 |
| unclassified Nectriaceae | Mdf-26 | 2.0 |
| Thelonectria | Mdf-1, Mdf-17 | 4.0 |
| Cephalosporium | Mdf-4, Mdf-48 | 4.0 |
| Leptosphaeria | Mdf-2, Mdf-9, Mdf-12, Mdf-16, Mdf-20, Mdf-29, Mdf-33, Mdf-34, Mdf-37, Mdf-40, Mdf-46 | 21.6 |
| Alternaria | Mdf-27, Mdf-30, Mdf-31, Mdf-32, Mdf-39, Mdf-41, Mdf-42, Mdf-44, Mdf-45, Mdf-49, Mdf-50, Mdf-51 | 23.5 |
| Acrocalymma | Mdf-35 | 2.0 |
| Cladosporium | Mdf-14 | 2.0 |
| Macrophomina | Mdf-19 | 2.0 |
| Phomopsis | Mdf-24 | 2.0 |
| Mucor | Mdf-21 | 2.0 |
Fig. 2.
Phylogenetic relationship of isolated fungal endophytes and reference fungal based on ITS gene sequences. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The GenBank accession numbers of ITS sequences are given in the parentheses. The scale bar represents 0.05 nucleotide changes.
Table III
PKS and NRPS genes in endophytic bacteria isolated from Paeonia ostii.
| Gene | No. of isolates | Amino acid residues | Accession number | Top BLASTP match (GenBank accession No.) | Identity (%) | Predicted binding pocket (amino acid substrate) |
|---|---|---|---|---|---|---|
| PKS | Md1-2 | 226 | MF589505 | polyketide synthase, Nostoc sp. (AGJ72843) | 144/226(64%) | Not done |
| PKS | Md1-4 | 227 | MF589506 | polyketide synthase, Bacillus sp. (ACG70843) | 226/227(99%) | Not done |
| PKS | Md1-6 | 227 | MF589507 | type I ketosynthase, Bacillus sp. (AIO09656) | 220/224(98%) | Not done |
| PKS | Md1-9 | 224 | MF589508 | type I ketosynthase, Bacillus sp. (AIO09656) | 220/222(99%) | Not done |
| PKS | Md1-21 | 223 | MF589509 | type I ketosynthase, Bacillus sp. (AIO09652) | 222/222(100%) | Not done |
| PKS | Md1-24 | 227 | MF589510 | polyketide synthase, Bacillus sp. (ACG70842) | 224/227(99%) | Not done |
| PKS | Md1-37 | 227 | MF589511 | polyketide synthase, Bacillus sp. (ACG70841) | 226/227(99%) | Not done |
| PKS | Md1-41 | 227 | MF589512 | polyketide synthase, Bacillus sp. (ACG70841) | 226/227(99%) | Not done |
| PKS | Md1-43 | 226 | MF589513 | type I ketosynthase, Bacillus sp. (AIO09656) | 219/224(98%)) | Not done |
| PKS | Md1-44 | 224 | MF589514 | type I ketosynthase, Bacillus sp. (AIO09656) | 218/222(98%) | Not done |
| PKS | Md1-45 | 229 | MF589515 | polyketide synthase, Bacillus sp. (ACG70842) | 226/229(99%)) | Not done |
| PKS | Md1-50 | 227 | MF589516 | polyketide synthase, Bacillus sp. (ACG70843) | 227/227(100%) | Not done |
| PKS | Md1-51 | 223 | MF589517 | type I ketosynthase, Bacillus sp. (AIO09656) | 221/222(99%) | Not done |
| NRPS | Md1-2 | 232 | MF589518 | non-ribosomal peptide synthetase, Streptomyces hiroshimensis(BAH68742) | 158/217(73%) | DFECLSVVT-(Val) |
| NRPS | Md1-18 | 232 | MF589519 | non-ribosomal peptide synthetase, Streptomyces hiroshimensis (BAH68742) | 158/217(73%) | DFECLSVVT-(Val) |
| NRPS | Md1-24 | 252 | MF589520 | nonribosomal peptide synthase, Bacillus sp. (KIA75709) | 249/252(99%) | DAKDLGVVD-(Glu) |
| NRPS | Md1-47 | 233 | MF589521 | non-ribosomal peptide synthetase, Pseudomonas sp. (WP_085703687) | 225/233(97%) | DAWVFGVVI-(Glu) |
| NRPS | Md1-50 | 245 | MF589522 | non-ribosomal peptide synthetase, Bacillus velezensis (WP_069007535) | 243/245(99%) | DFWNIGMVH-(Thr) |
Table IV
PKS and NRPS genes in endophytic fungi isolated from Paeonia ostii.
| Gene | No. of isolates | Amino acid residues | Accession number | Top BLASTP match (GenBank accession No.) | Identity (%) | Predicted binding pocket (amino acid substrate) |
|---|---|---|---|---|---|---|
| PKS | Mdf-4 | 250 | MF680559 | related to fusarin C cluster-polyketide synthase/NRPS, Rhynchosporium agropyri (CZS94917) | 222/250(89%) | Not done |
| PKS | Mdf-15 | 238 | MF680560 | ketoacyl-synt-domain-containing protein, Coniochaeta ligniaria (OIW26903) | 201/240(84%) | Not done |
| PKS | Mdf-17 | 211 | MF680561 | beta-ketoacyl synthase domain-containing protein, Metarhizium album (KHO00577) | 201/240(84%) | Not done |
| PKS | Mdf-26 | 231 | MF680562 | PKS protein, Trichoderma parareesei (OTA00034) | 175/231(76%) | Not done |
| PKS | Mdf-41 | 234 | MF680563 | polyketide synthase PksF, Alternaria alternata (XP_018382155) | 233/234(90%) | Not done |
| PKS | Mdf-43 | 238 | MF680564 | ketoacyl-synt-domain-containing protein, Coniochaeta ligniaria (OIW26903) | 227/234(97%) | Not done |
| PKS | Mdf-44 | 234 | MF680565 | polyketide synthase PksF, Alternaria alternata (XP_018382155) | 131/217(60%) | Not done |
| PKS | Mdf-47 | 250 | MF680566 | related to fusarin C cluster-polyketide synthase/NRPS, Rhynchosporium agropyri (CZS94917) | 233/234(99%) | Not done |
| PKS | Mdf-49 | 234 | MF680567 | polyketide synthase PksF, Alternaria alternata (XP_018382155) | 233/234(99%) | Not done |
| PKS | Mdf-51 | 234 | MF680568 | polyketide synthase PksF, Alternaria alternata (AFN68297) | 233/234(99%) | Not done |
| NRPS | Mdf-2 | 244 | MF680550 | acetyl-CoA synthetase-like protein, Stagonospora sp. (OAK98265) | 218/244(89%) | No prediction |
| NRPS | Mdf-6 | 234 | MF680551 | nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793) | 195/235(83%) | DIGFVGGIF-(Ile) |
| NRPS | Mdf-8 | 231 | MF680552 | nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793) | 208/231(90%) | DVTLVGCVV-(Cys) |
| NRPS | Mdf-9 | 222 | MF680553 | nonribosomal peptide synthetase, Cenococcum geophilum (OCK98900) | 195/222(88%) | DVAFIGSIH-(Phe) |
| NRPS | Mdf-18 | 228 | MF680554 | nonribosomal peptide synthetase, Cenococcum geophilum (OCK98900) | 198/228(87%) | DVAFIGSIH-(Phe) |
| NRPS | Mdf-20 | 246 | MF680555 | acetyl-CoA synthetase-like protein, Stagonospora sp. (OAK98265) | 223/246(91%) | No prediction |
| NRPS | Mdf-22 | 238 | MF680556 | nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793) | 220/237(93%) | DAMLVGAVI-(Gln) |
| NRPS | Mdf-41 | 240 | MF680557 | nonribosomal peptide synthase, Alternaria alternata (XP_018382376) | 201/240(84%) | DAILVGAVV-(Gln) |
| NRPS | Mdf-50 | 238 | MF680558 | nonribosomal peptide synthetase 1, Neonectria ditissima (KPM37793) | 217/237(92%) | DAMLVGAVI-(Gln) |
Fig. 3.
The phylogenetic relationship of endophytic bacteria based on PKSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.1 amino acid changes.
Fig. 4.
The phylogenetic relationship of endophytic bacteria based on NRPSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.10 amino acid changes.
Fig. 5.
The phylogenetic relationship of endophytic fungi based on type I PKSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.10 amino acid changes.
Fig. 6.
The phylogenetic relationship of endophytic fungi based on NRPSs amino acid sequences homology. The numbers at nodes represent the percentage levels of bootstrap support (%) (expressed as percentages of 1000 replications). The scale bar represents 0.20 amino acid changes.