Fig. 1.
Fig. 2.
Fig. 3.
Fig. 4.
Fig. 5.
Fig. 6.
Fig. 7.
Fig. 8.
The degree of identity and length of the covered sections of sequences as defined by the BLAST methods_
| Species | Strain/isolate | The analyzed sequences from GenBank accession No. | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| ITS | LSU | β-tubulin | ||||||||
| No. GenBank | The degree of identity of sequence [%] = identity | Query cover nucleotides | No. GenBank | The degree of identity of sequence [%] = identity | Query cover nucleotides | No. GenBank | The degree of identity of sequence [%] = identity | Query cover nucleotides | ||
| Aspergillus penicillioides | isolate B1-8 | KF986414.1 | 100 | 569 | ||||||
| Aspergillus penicillioides | UFMGCB 6310 | KF373543.1 | 100 | 498 | ||||||
| Aspergillus sp. | DY115-21-7-M6 | KF411572.1 | 100 | 551 | ||||||
| Uncultured fungus | clone LX042233-122-012-B01 | GQ999240.1 | 99 | 574 | ||||||
| Aspergillus penicillioides | isolate KH00279 | GU017500.1 | 99 | 574 | GU017541.1 | 99 | 835 | |||
| Aspergillus penicillioides | isolate KH00251 | GU017494.1 | 99 | 574 | GU017535.1 | 100 | 833 | |||
| Uncultured fungus | clone PR-MAT-CV5-17 | FJ265955.1 | 99 | 574 | ||||||
| Aspergillus sp. | F55 | FJ755819.1 | 99 | 574 | ||||||
| Aspergillus penicillioides | strain WR1996 | KP997215.1 | 99 | 544 | ||||||
| Aspergillus penicillioides | Culture collection CCF<CZE> 3112 | FR727125.1 | 99 | 573 | ||||||
| Uncultured fungus | clone PR-MAT-CV5-19 | FJ265957.1 | 99 | 571 | ||||||
| Aspergillus penicillioides | isolate HNC15-78 | KT959298.1 | 99 | 530 | ||||||
| Uncultured fungus | clone xnh90 | KP063524.1 | 99 | 574 | ||||||
| Aspergillus sp. | 43m | KC834810.1 | 99 | 527 | ||||||
| Uncultured Aspergillus | clone CHiv38 | KP974191.1 | 99 | 574 | ||||||
| Uncultured fungus | clone xnh20 | KP063454.1 | 99 | 574 | ||||||
| Uncultured Aspergillus | clone Leof80 | KF225869.1 | 99 | 574 | ||||||
| Aspergillus penicillioides | clone KJ34-0.2-39 | KT390118.1 | 99 | 791 | ||||||
| Aspergillus penicillioides | U81265.1 APU81265 | 99 | 783 | |||||||
| Aspergillus sp. | CCF 3112 | FR775323.1 | 97 | 506 | ||||||
Primers used in PCR reaction_
| Name | Primer | Primer sequence 5’-3’ | Melting temperature (Tm) °C | Primer orientation | Reference |
|---|---|---|---|---|---|
| ITS primers | ITS1 | TCCGTAGGTGAACCTGCGG | 59 | Forward | Ref. 28 |
| ITS4 | TCCTCCGCTTATTGATATGC | 59 | Reverse | Ref. 28 | |
| LSU primers | LROR | ACCCGCTGAACTTAAGC | 60 | Forward | Ref. 28 |
| LR5 | TCCTGAGGGAAACTTCG | 60 | Reverse | Ref. 29 | |
| β-tubulin primers | Bt2a | GGTAACCAAATCGGTGCTGCTTTC | 60 | Forward | Ref. 30 |
| Bt2b | ACCCTCAGTGTAGTGACCCTTGGC | 60 | Reverse | Ref. 30 |