Table I
Primer sets used in this study.
| Probes | Sequence | Descriptiona |
|---|---|---|
| 27F | 5’ AGAGTTTGATCCTGGCTCAG 3’ | 16S rDNA universal primers, positions 8–27 and 704–685 and 1512–1492, resp. in the E. coli K12 [NC_000913] numbering system; (Lane, 1991) |
| 1492R | 5’ ACGGCTACCTTGTTACGACTT 3’ | |
| 2555nccAF | 5’ AGCCG (C,G) GA (C,G) AACGG CAAGCG 3’ | 2536–2555 and 3136–3117 degenerative nccA primers, positions on plazmid p9 in the Achromobacter xylosoxidans 31A [L31363] numbering system; (Karelová et al., 2011) |
| 3117nccAR | 5’ CCGATCACCACCGT (T,C) GC CAG 3’ | |
| nccA9F | 5’ ACGTATCATTAGTTTCGCCA 3’ | 1861923–1861904 and 1859057–1859076 nccA primers, positions on chromosome in the Ralstonia picketii 12J [CP001068] numbering system; This work |
| nccA2875R | 5’ ATCGGATAAACGACAGCATC 3’ | |
| nccA1244F | 5’ GCTCTCGAAAGAGGAAGGCA 3’ | 1862989–1862970 and 1861746–1861765 nccA primers, positions on chromosome in the Ralstonia picketii 12J [CP001068] numbering system; This work |
| nccA1244R | 5’ TTCGGTTTCGAGCGGTGAAT 3’ | |
| nccA642F | 5’ GCTAGTCTTCACGGGCATT 3’ | 1859211–1859193 and 1858570–1858589 nccA primers, positions on chromosome in the Ralstonia picketii 12J [CP001068] numbering system; This work |
| nccA642R | 5’ GCTCTTCGTCATGACACCAC 3’ | |
| nccA923F | 5’ GGTCGCTTCCATTAACCG 3’ | 1860996–1860979 and 1860074–1860091 nccA primers, positions on chromosome in the Ralstonia picketii 12J [CP001068] numbering system; This work |
| nccA923R | 5’ GATCGGATGCAATCTCCG 3’ | |
| nccA-F | 5’ GTCGCCTTGTTCATCGG 3’ | 1860425–1860409 and 1860301–1860319 nccA primers, positions on chromosome in the Ralstonia picketii 12J [CP001068] numbering system; This work |
| nccA-R | 5 GCAAACGTCAATACAACGG 3’ | |
| gdhA-F | 5’ CGTACTCAATGAACGAAGGC 3’ | 388722–388741 and 388866–388850 gdhA primers, positions on chromosome in the Ralstonia picketii 12D [CP001644] numbering system; This work |
| gdhA-R | 5’ TCGATGCCGAGATTGCG 3’ | |
| UP1 | 5’ GAAGTCATCATGACCGTTCTG CA(TC)GC(TCAG)GG(TCAG)GG (TCAG)AA(AG)TT(TC)GA 3’ | gyrB gene primers, positions 91–104 and 495–509 amino acid residues (the numbering corresponds to that of the E. coli K12 protein [(GYRB_ECOLI in the SWISS-PROT database)]) (Yamamoto and Harayama, 1995) |
| UP2r | 5’ AGCAGGGTACGGATGTGCGAG CC(AG)TC(TCAG)AC(AG)TC(TC AG)GC(AG)TC(TCAG)GTCAT 3’ | |
| UP-1S | 5’ GAAGTCATCATGACCGTTCT GCA 3’ | |
| UP-2Sr | 5’ AGCAGGGTACGGATGTGCG AGCC 3’ |

Fig. 1.
Unrooted phylogenetic tree obtained by the maximum likelihood method with 100 bootstrap replications showing phylogeny of 16S rRNA (16S rDNA) gene sequences of MR-CH-I2 isolate (in bold) and members of the genera Ralstonia, Cupriavidus and Alcaligenes, respectively. Rhizobium sp. SCAU231 [HQ538623], Pseudomonas fluorescens strain MPF25 [AB621592], Streptomyces badius strain 3504 [JN180190], Olivibacter soli strain Gsoil 034 [NR_041503] and Brevibacillus parabrevis C8 [KX832687] were used as out-group. Numbers in square brackets indicate the GenBank accession number and similarity to closest relative is shown after the clone designation. Sequences of about 1 500 bp in length were aligned with ClustalW.

Fig. 2.
Unrooted phylogenetic tree obtained by the maximum likelihood method with 100 bootstrap replications showing phylogeny of partial gyrB sequences based on 399 presented amino acid sites translated from DNA of MR-CH-I2 isolate (in bold) and members of the genera Ralstonia, Cupriavidus and family Burkholderiaceae, respectively. Rhizobium sp. CF394 [WP_037131562], Pseudomonas aeruginosa [WP_073671677] and Bacillus thuringiensis [ACQ94972] served as outgroup. Numbers in square brackets indicate the GenBank accession number and similarity to closest relative is shown after the clone designation. Sequences were aligned with ClustalW.

Fig. 3.
Pulsed-field gel electrophoresis analysis of high molecular plasmids from bacterium MR-CH-I2.
Legends: Lane 1 = mass standard (Lambda Ladder PFGE Marker); lane 2 = plasmid from isolate MR-CH-I2; lane 3 = control sample (without plasmid); lane 4 = mass standard (1 Kb DNA Ladder). The arrow indicates the band of about 50 kb in size.

Fig. 4.
The whole MR-CH-I2-nccA [KR476581] gene sequencing strategy of MR-CH-I2 isolate (cf. Detection of complete nccA-like gene and its sequencing strategy in section Materials and methods and Table I).
Legends: Numbers in bold indicate positions of the MR-CH-I2-nccA gene (dark-skinned grey arrow) and its neighbourhood areas (light grey arrow) on chromosome in the Ralstonia picketii 12J [CP001068] numbering system; thin arrows indicate positions of appropriate primers on the MR-CH-I2-nccA gene and its neighbourhood areas; nccA1244F and nccA1244R primers were used for sequencing of the beginning of the MR-CH-I2-nccA gene; nccA9F and nccA2875R primers were used for sequencing of the beginning and terminal parts of the middle area of the MR-CH-I2-nccA gene; nccA923F and nccA923R primers were used for sequencing of the middle parts of the middle area of the MR-CH-I2-nccA gene; nccA642F and nccA642R primers were used for sequencing of terminal part of the MR-CH-I2-nccA gene.

Fig. 5.
Unrooted phylogenetic tree obtained by the maximum likelihood method with 100 bootstrap replications showing phylogeny of whole nccA-like sequences based on 1,063 presented amino acid sites translated from DNA of the MR-CH-I2 isolate (in bold). Numbers in square brackets indicate the GenBank accession number and similarity to closest relative is shown after the clone designation. Sequences were aligned with ClustalW.
Table II
Expression of MR-CH-I2-nccA [KR476581] gene after heavy metal additions to the medium.
| Time (h) | Nickela | Cadmiuma | Cobalta | Coppera | Zinca | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| ΔΔCt | RQ | ΔΔCt | RQ | ΔΔCt | RQ | ΔΔCt | RQ | ΔΔCt | RQ | |
| 0 | 0.00 | 1.00 | 0.00 | 1.00 | 0.00 | 1.00 | 0.00 | 1.00 | 0.00 | 1.00 |
| 2 | –4.08 | 16.91 | 0.53 | 0.69 | 3.23 | 0.11 | 5.50 | 0.02 | 1.81 | 0.29 |
| 4 | –0.17 | 1.13 | 6.32 | 0.01 | 5.18 | 0.03 | 6.61 | 0.01 | 3.17 | 0.11 |
| 6 | –0.51 | 1.42 | 5.82 | 0.02 | 5.22 | 0.03 | 9.38 | 0.002 | 3.65 | 0.08 |
| 8 | 0.67 | 0.63 | 6.13 | 0.01 | 7.61 | 0.005 | 7.52 | 0.005 | 2.81 | 0.14 |
2a Standardization of gene expression according to the house-keeping gene after heavy metal additions;
Ct – threshold cycle;
ΔΔCt = ΔCt1 (CtnccA – CtnccA–Control) – ΔCt2 (CtgdhA – CtgdhA–Control);
RQ = 2–ΔΔCt;
nccA – MR-CH-I2-nccA [KR476581] (nccA-like heavy-metal resistance gene) of MR-CH-I2 bacterium;
gdhA – the gene encodes glutamate dehydrogenase (house-keeping gene).