Introduction
Lymphoedema, swelling due to excess accumulation of the protein-rich lymph in the tissues, is caused by inadequate lymph reabsorption or when the lymphatic vessels are absent or function defectively.1 Primary lymphoedema is affecting approximately 1.15/100,000 of less than 20 years of age population.2 Affected individuals suffer from chronic lymphoedema and are at greater risk for developing infections, including bacterial infection of the skin and underlying tissue (cellulitis) or infection of the lymphatic vessels (lymphangitis).3 They are also at a greater risk than the general population for developing a malignancy, at the affected site. The most common malignancy associated with the affected area is the angiosarcoma4-6 (the condition called the Stewart-Treves syndrome), however, also other malignancies, the basal cell carcinoma, squamous cell carcinoma, melanoma, Kaposi sarcoma, Merkel cell carcinoma, and several cutaneous lymphomas6 can occur, and are probably due to the immunocompromised district of the affected area or because of the environment rich in growth factors due to the formation of collateral lymphatic vessels.6 Therefore, identification (also with the aid of genetic testing) and monitoring of patients with chronic lymphoedema (no matter the etiology) should be performed periodically to identify and treat malignant changes that can develop in the affected areas.6
The clinical presentation of primary lymphoedema is very variable and varies in the age of onset, the edematous part of the body affected, associated anomalies and different inheritance patterns.7 The most recent classification of primary lymphoedema has been developed as a diagnostic algorithm, proposed by Connell in 20107 and 20138, and is based first on different clinical presentations and second on the genetic findings.
The genetic basis of primary lymphoedema are mutations in five causative genes that also underlie specific forms of the disease9,10 namely: FLT4 (fms-related tyrosine kinase 4 encoding VEGFR-3 (vascular endothelial growth factor receptor 3)) mutations, that cause Milroy disease11-15; CCBE1 (collagen and calcium binding EGF domain containing protein 1) mutations that are responsible for autosomal-recessive generalized lymphatic dysplasia16-18; SOX18 (sex determining region Y-box 18) mutations that account for the hypotrichosis–lymphoedema–telangiectasia syndrome19; GJC2 (gap junction protein gamma 2, encoding (CX47) connexin-47) mutations which were identified in patients with four-limb lymphoedema20,21 and FOXC2 (fork head box protein C2) mutations that are responsible for autosomal dominant lymphoedema distichiasis syndrome (LDS).22,23 With the advent of the next generation sequencing technology, mutations in the number of new candidate genes (NRP2 (neuropilin 2), SOX17 (sex determining region Y-box 17), FABP4 (fatty acid binding protein 4), VCAM1 (vascular cell adhesion molecule 1) have been also linked to primary lymphoedema.10,24
In patients with LDS, lymphoedema of both lower limbs, that typically starts in late childhood or during puberty10,15, and varicose veins are accompanied by extra eyelashes (known as distichiasis) and also other comorbidities, such as ptosis (35% of patients), congenital heart disease (8%) and cleft palate (3%).7,8,15 In the majority (95%) of patients with LDS, mutations in the FOXC2 gene, on chromosome 16q24, are responsible for the disease (15). FOXC2 encodes a transcription factor for the signal transduction pathway ensuring normal development of the lymphatic collecting vessels and valves.25
Besides causing LDS, FOXC2 mutations have also been identified in lymphoedema without distichiasis.26 Therefore, the aim of our study was to search for causative mutations in the FOXC2 gene in three generations of a family with lymphoedema of lower limbs without distichiasis.
Patients and methods
Patients
Three family members, a 39-year-old woman, her 74-year-old father and 14-year-old son, have been diagnosed with primary lymphoedema at the Dermatovenerological Clinic, University Clinical Centre Ljubljana.
The 74-year-old has lymphoedema of both lower limbs stage III with fibrosis and sclerosis with only some small reticular veins present and genital edemas with lymphatic cysts. The disease started when the patient was 11 years old. The patient does not have distichiasis, ptosis, and cleft palate. There is no known history of lymphoedema in the patient’s family and his wife, who had died, also did not have any history of lymphoedema. The patient has suffered a myocardial infarction in 2007 and had a mitral and a tricuspid valve replacement. Patient is being treated with short-stretch bandages and manual lymph drainage and in the maintenance phase with compression garments (bermuda shorts, and flat knitted thigh high stocking class III). Before therapy, he had suffered several erysipelas which have not reoccurred after regular therapy for lymphoedema.
The 39-years-old daughter has lymphoedema stage III of both lower limbs without genital involvement, with the disease onset at age 9. The patient, like her father, also does not have distichiasis, ptosis or cleft palate. She has varicose veins present on both of her legs. Her husband does not have lymphoedema. She is being treated with flat knitted thigh high stocking class III. Again, she had suffered several erysipelas which were stopped after regular therapy for lymphoedema. She has three children.
In her son, lymphoedema stage II of both lower limbs first occurred at the age of 13. He has no other pathological clinical findings. He is being treated with round knitted stockings class II. He has not suffered any erysipelas.
Both her daughters aged 9 and 6 years have no symptoms and signs of lymphoedema. Age, gender, and detailed clinical characteristics of the recruited subject are presented in Table 1.
Table 1
Clinical findings of family members with primary lymphoedema
| Patients | |||||
|---|---|---|---|---|---|
| Gender | M | F | M | F | F |
| Age (years) | 74 | 39 | 14 | 9 | 6 |
| Lymphoedema | Yes | Yes | Yes | No | No |
| Lower limbs | Yesa | Yesa | Yesb | No | No |
| Genital | Yes | No | No | No | No |
| Distichiasis | No | No | No | No | No |
| Onset (years) | 11 | 9 | 13 | / | / |
| Varicose veins | Yes | Yes | No | No | No |
| Ptosis | No | No | No | No | No |
| Cleft palate | No | No | No | No | No |
| Congenital heart disease | No | No | No | No | No |
| FOXC2 mutation | c.867insA | c.867insA | c.867insA | No | c.867insA |
| Cellulitis | Yes | Yes | No | No | No |
| Yellow nails | No | No | No | No | No |
F = female; M = male
The study was approved by the Slovenian national ethics committee (number: 157/07/10) and all participants gave their informed written consent.
Genetics analysis
Genomic DNA was extracted from EDTA-containing whole blood samples using a QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The detection of FOXC2 mutations in the 1506 bp single exon coding region, as well as in the 5’ and 3’ regions of FOXC2 gene was performed as previously described.26,27 The primer sequence and conditions used are presented in Table 2. PCR products were sequenced using Big Dye Terminator kit (Thermo Fisher Scientific) and 3730xl DNA analyzer (Thermo Fisher Scientific). To identify mutations, sequences were compared with the FOXC2 reference sequence in the GenBank (GenBank accession number NG_012025.1) using the SeqScape Software v2.6 (Thermo Fisher Scientific). Mutations numbering is based on cDNA sequence, where the first nucleotide (A) of the initiation codon (ATG) is considered nucleotide number one.
Table 2
Primer sequences and conditions used to amplify and sequence the FOXC2 gene and its upstream and downstream regions
| Name of primer | Sequence (5˘-3˘) | Annealing temp (°C) | Product size (bp) | DMSO % | MgCl2 mM |
|---|---|---|---|---|---|
| FOXC2-1F a | TCTGGCTCTCTCGCGCTCT | 58 | 476 | 6 | 1.5 |
| FKHL14-2R | AGTAACTGCCCTTGCCGG | ||||
| FOXC2-2F a | ACCGCTTCCCCTTCTACCGG | 60 | 519 | 10 | 1.5 |
| FOXC2-2R | TCATGATGTTCTCCACGCTGAA | ||||
| FKHL14-4F a | GAAGGTGGTGATCAAGAGCG | 60 | 496 | 6 | 1.5 |
| FOXC2-3R | GAGGTTGAGAGCGCTCAGGG | ||||
| FOXC2-4F a | CTGGACGAGGCCCTCTCGGAC | 61 | 464 | 10 | 1.5 |
| FOXC2-4R | GGAGGTCCCGGGACACGTCA | ||||
| FOX_5P_1F b | GCCGACGGATTCCTGCGCTC | 61 | 378 | 10 | 1.5 |
| FOX_5P_1R | CCGCTCCTCGCTGGCTCCA | ||||
| FOX_5P_2F b | CCGATTCGCTGGGGGCTTGGAG | 61 | 607 | 6 | 1.5 |
| FOX_5P_2R | GCGGGCTGGTGGTGGTGGTAGG | ||||
| FOX_3P_1F b | CAACGTGCGGGAGATGTTCAAC | 61 | 464 | 10 | 1.5 |
| FOX_3P_1R | CACAGCACAGCCGTCCTGGTAG | ||||
| FOX_3P_2F c | TACTGACGTGTCCCGGGACC | 61 | 468 | 6 | 1.5 |
| FOX_3P_2R | CCACACATTTGTACAGCACGGTTG |
a = Primer pairs from27
a = Primer pairs from27
a = Primer pairs from27
a = Primer pairs from27
b = Primer pairs from28
b = Primer pairs from28
b = Primer pairs from28
c = Primer pairs from26
Results
Clinical details
The clinical detail of all five patients are shown in Table 1.
Genetics analysis
In all affected members of the described three generation family with lymphoedema of lower limbs without distichiasis the same mutation in FOXC2 responsible for the disease was identified (Figure 1). The mutation identified in our patients is a heterozygous insertion of adenosine (c.867insA) and was not previously described. This insertion was present in three family members affected by primary lymphoedema, as well as in a six years old girl without any symptoms and signs of lymphoedema at the time of analysis, while it was absent in a healthy nine years old girl.

Figure 1
Pedigree of the family with new mutation in FOXC2 gene. Full symbols indicate patients with lymphoedema, asterisk (*) indicate year of birth of the recruited subjects and subjects with c.867insA FOXC2 mutation are indicated as FOXC2 (+).
Since the discovered mutation was not previously reported we additionally evaluated this mutation in 182 normal controls. None of the controls harbored the mutation, which further supports the causative nature of the mutation.
Discussion
Up to date only one lymphedema family with FOXC2 mutation without any individual with distichiasis was found.26 We report the second family of three generations with FOXC2 mutation and in which all affected individuals demonstrated lymphedema without distichiasis. Molecular analysis helped to identify the causative heterozygous insertion of adenosine (c.867insA) in the FOXC2 gene, which was previously not described. This mutation causes frameshift and premature termination of the mature protein since stop codon is inserted behind amino acid 461, leading to a truncation of the mature protein and consequently to the elimination of key alpha-helical domains required for the transcription process.26 Frameshift mutations are expected to alter the reading frame or lead to a premature termination of the protein, and as a result those unstable mRNA transcripts are removed through the nonsense-mediated mRNA decay pathway.28,29 The causative nature of the identified variant was further supported by the fact that the mutation was not found in any of the 182 tested normal controls.
In all three patients of our family, lymphoedema developed between the age of 9 and 13. The onset of lymphoedema in literature is typically during puberty or in late childhood.7,26,30 In the 6 years old girl without clinical manifestations of lymphoedema with mutation in FOXC2, lymphoedema will very likely develop within the next few years. She also has no other clinical findings that were described in patients with FOXC2 mutations. All three patients have lymphoedema of both lower limbs like the patients described in the literature.14,28 Because of delayed therapy with compression in the female patient and her father, lymphoedema of the legs is in the IIIrd stage. Patient’s father also has lymphoedema of genital region with occasional lymphorrhea. Several papers have mentioned that lymphoscintigraphy, because of valve failure, indicate distal lymph reflux in patients with LDS.6,29,31 In our two older patients not only early therapy, but also lymphoscintigraphy have been performed in other institutions abroad, and thus unfortunately any information about those findings are not available. Also for the young boy, his mother did not allow to perform early diagnostic procedures, because of known family diagnosis. Both, the patient and her father had suffered many erysipelas before therapy. After regular wearing of compression garments erysipelas were stopped. The son started with compression stockings class II immediately after the onset of edema. He has lymphoedema stage II with morning swelling, without sequelae. Our female patient and her father both have reticular varicose veins without reflux. In the literature lymphoedema and varicose veins are accompanied by distichiasis, which occur in 94.3% of the patients with mutations in the FOXC2 gene.15,32 Affected individuals can also have ptosis (in 35% of patients), congenital heart disease (8%), clef palate (3%) and in some patients yellow nails and cystic hygromas have been described.26 In our patients there were no distichiasis, no cleft palate, no ptosis or yellow nails, no congenital heart defects or cystic hygromas.
Mutations in the FOXC2 appear to be the primary cause of LDS. However, not only that some features of the LDS phenotype can be found in patients without FOXC2 mutations26 our study and also previous report26 obviously suggest that mutations in the FOXC2 gene can be found in lymphoedema patients without distichiasis.
The FOXC2 gene encodes for a forkhead transcription factor implicated in the development of lymphatic and vascular system, particularly affecting the function of the valves.25,32 The role has been implicated from animal models where it is expressed in developing mesenchymal cells which develop into blood and lymphatic vessels. Moreover, homozygous null mice (foxc2-/-) have non-functioning blood vessels.25,32 In humans FOXC2 mutations were associated with primary valve failure and venous reflux, indicating its requirement for proper venous function.15,25,32 Mutations in FOXC2 most often cause LDS, with lymphoedema of lower extremities, distichiasis, and the disease onset usually after puberty.7,8,10,15,26,32-35 However, the penetrance and disease expression seems to be highly variable. This was also confirmed by our family in which none of the patients with the novel FOXC2 mutation had distichiasis.
Conclusions
In conclusion, we identified a causative previously unreported insertion in FOXC2 in affected members of three generation family with lymphoedema of lower limbs without distichiasis, highlighting the high heterogeneity of phenotypic variability caused by FOXC2 mutations.