Table 1
Patients’ demographics and glioma histopathological classification
| Patients demographic | ||
|---|---|---|
| Number of patients | 157 | |
| Gender (female/male) | 67/90 (1 : 1.34) | |
| Mean age at diagnosis (years) | 43.8 (SD ±18,89) | |
| # < 45 years | 86 | |
| # > 45 years | 71 | |
| Glioma classification | Glioma subtype | WHO grade |
| Astrocytoma (AC) | 15 pilocytic | WHO I |
| 9 diffuse | WHO II | |
| 11 diffuse with signs of anaplasia | WHO II-III | |
| 9 anaplastic | WHO III | |
| 23 secondary GBM | WHO IV | |
| 31 primary GBM | WHO IV | |
| Oligodendroglioma (ODG) | 4 diffuse | WHO II |
| 5 diffuse with signs of anaplasia | WHO II-III | |
| 28 anaplastic | WHO III | |
| Oligoastrocytoma (OAC) | 2 diffuse | WHO II |
| 3 diffuse with signs of anaplasia | WHO II-III | |
| 17 anaplastic | WHO III |
Table 2
Primers used for validation of LOC285758 expression profiling results, reference genes and determining methylation status of lncRNA’s promoter
| Quantitative real-time PCR | |||
|---|---|---|---|
| Gene | Assay ID | Amplicon length (bp) | Annealing temperature (°C) |
| LOC285758 | Hs.PT.58.26012748 | 129 | 60 |
| GAPDH | QT00079247 | 95 | 55 |
| Gene | Primer sequence (5’ - 3’) | Amplicon length (bp) | Annealing temperature (°C) |
| U6 | CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT | 94 | 60 |
| Methylation sensitive HRM | |||
| Gene | Oligonucleotide sequence (5’ – 3’) | Amplicon length (bp) | Annealing temperature (°C) |
| LOC285758 F | TTGTTTTTTGAAAGTTTTTTGA | 118 | 55 |
| LOC285758 R | AAACACAAAAAACCTAACAAAAA | ||
Figure 1
Venn’s diagram of lncRNAs that were significantly differentially expressed using microarray screening of lncRNAs involved in epigenetic mechanisms and/or pathways. (A) Number of lncRNAs in regard to the number of subtypes in which they were found differentially expressed (the number of subtypes rises from the outer circle (one subtype) towards the inner one (four subtypes)). (B) The number of lncRNAs found differentially expressed in all four analysed subtypes (using two levels of stringency – absolute fold change cut-off value of 1.5 and (2)).
Table 3
Top 10 lncRNAs that showed significantly increased/decreased expression in four glioma subtypes, using the LncPath Human Epigenetic Pathway microarray (ArrayStar, USA)
| Astrocytoma II+III* | Secondary GBM | Primary GBM | Oligodendroglioma | ||||
|---|---|---|---|---|---|---|---|
| FC(abs) | Gene Name | FC(abs) | Gene Name | FC(abs) | Gene Name | FC(abs) | Gene Name |
| TOP 10 OVER-EXPRESSED | |||||||
| 9.775 | RP11-434O22.1 | 9.840 | APOC2 | 11.343 | AK024556 | 10.085 | RP6-201G10.2 |
| 7.863 | LOC285758 | 9.105 | AK024556 | 9.761 | FJ209302 | 7.233 | LOC285758 |
| 6.203 | LOC100129034 | 7.971 | LOC100129034 | 9.402 | AK055628 | 6.241 | GAS5 |
| 5.247 | RP11-264F23.3 | 7.578 | AK055628 | 9.267 | H19 | 5.454 | RP11-264F23.3 |
| 5.211 | RP6-201G10.2 | 4.509 | RP11-145M9.3 | 7.012 | RP11-434O22.1 | 5.360 | LOC100216546 |
| 5.107 | APOC2 | 4.243 | RP11-73E17.2 | 6.720 | APOC2 | 5.043 | SNRPE |
| 4.374 | RP11-770J1.3 | 3.657 | KB-1836B5.1 | 5.527 | LOC285758 | 4.991 | AK024556 |
| 4.211 | HOXA11-AS | 3.394 | H19 | 4.851 | LOC100216546 | 4.930 | AC009506.1 |
| 3.861 | RP3-405J24.1 | 2.878 | BANCR | 4.770 | LOC100129034 | 4.351 | RP11-73E17.2 |
| 3.795 | AK055628 | 2.695 | AB447886 | 4.525 | HOXA11-AS | 3.846 | LOC286059 |
| TOP 10 UNDER-EXPRESSED | |||||||
| 9.638 | RP11-678P16.1 | 24.555 | MEG3 | 22.494 | MEG3 | 43.328 | RP11-678P16.1 |
| 7.026 | XLOC_013368 | 11.341 | AK054921 | 16.532 | AK054921 | 23.879 | FABP5P3 |
| 6.797 | AK054921 | 8.050 | AF520792 | 11.157 | RP11-678P16.1 | 18.840 | DGCR5 |
| 6.148 | MEG3 | 6.845 | DGCR5 | 8.208 | DGCR5 | 8.073 | MEG3 |
| 6.003 | RP11-18F14.2 | 6.623 | XLOC_013368 | 8.207 | XLOC_013368 | 7.092 | AK054921 |
| 5.820 | HAR1A | 6.470 | AK054970 | 7.979 | HAR1B | 6.887 | XLOC_013368 |
| 5.052 | SNAR-A2 | 6.243 | HAR1A | 6.325 | HAR1A | 6.318 | NEAT1 |
| 4.216 | FABP5P3 | 6.114 | XIST | 6.218 | SNAR-A2 | 6.205 | SEPT7P6 |
| 4.082 | RP11-325F22.4 | 5.799 | MIAT | 6.066 | RP11-208G20.2 | 6.090 | CASC2 |
| 3.887 | SEPT7P6 | 5.712 | SNAR-A2 | 5.652 | XLOC_008014 | 5.873 | TMSB10P2 |
Figure 2
(A) Differential expression of LOC285758 in individual samples (y-axis presents ΔΔCT values). (B) Comparison of average ΔΔCT values for individual glioma subtype, determined by microarray and qPCR. Oligoastrocytoma samples were not included in microarray analysis. ΔΔCT represents difference of gene’s expression in comparison to brain reference RNA, and the positive values mean that gene’s levels are increased. p-values were determined for qPCR data (ANOVA for comparing all five subtypes and Mann-Whitney U-test for comparing two subtypes).
Figure 3
Scatter plots showing (A) LOC285758 expression (qPCR) in association to methylation status. Unmethylated samples showed higher expression levels compared to methylated ones. (B) LOC285758 expression and promoter methylation status significantly differ regarding the WHO malignancy grade and (C) glioma subtype, especially comparing astrocytoma grade I-III (all samples were methylated) to grade IV (GBMs were largely unmethylated).
Promoter methylation: 0 = unmethylated, 1 = methylated
Table 4
Association of LOC285758 expression with patients demographic data and glioma hallmark biomarkers: mutations of IDH1 and TP53, copy number variations of CDKN2A and CDKN2B, and loss of chromosome arm 1p and 19q (1p/19q co-deletion)
| LOC285758 expression | LOC285758 promoter methylation | |||
|---|---|---|---|---|
| rs | p-value | rs | p-value | |
| Gender | -0.044 | 0.634 | 0.009 | 0.920 |
| Age at diagnosis (< 45y >) | 0.065 | 0.475 | -0.313 | < 0.001 |
| WHO grade (low/high) | 0.213 | 0.019 | -0.433 | < 0.001 |
| IDH1 (wt/mut) | 0.375 | < 0.001 | 0.096 | 0.331 |
| TP53(wt/mut) | -0.083 | 0.483 | 0.153 | 0.178 |
| 1p loss (wt/del) | 0.310 | 0.005 | -0.396 | < 0.001 |
| 19q loss (wt/del) | 0.267 | 0.032 | -0.360 | 0.002 |
| 1p/19q loss (wt/del) | 0.262 | 0.014 | -0.373 | < 0.001 |
| CDKN2A (wt/del) | 0.085 | 0.477 | -0.231 | 0.042 |
| CDKN2B (wt/del) | 0.093 | 0.435 | -0.240 | 0.033 |
[i] rs = Pearson’s correlation/association coefficient (0.2–0.4 – weak, 0.4–05 – moderate, > 0.6 strong correlation); p-value cut-off is set at 0.05 (95% confidence interval)