Expression of LOC285758, a potential long non-coding biomarker, is methylation-dependent and correlates with glioma malignancy grade

Matjasic, Alenka; Popovic, Mara; Matos, Bostjan; Glavac, Damjan

doi:10.1515/raon-2017-0004

Figures & Tables

Venn’s diagram of lncRNAs that were significantly differentially expressed using microarray screening of lncRNAs involved in epigenetic mechanisms and/or pathways. (A) Number of lncRNAs in regard to the number of subtypes in which they were found differentially expressed (the number of subtypes rises from the outer circle (one subtype) towards the inner one (four subtypes)). (B) The number of lncRNAs found differentially expressed in all four analysed subtypes (using two levels of stringency – absolute fold change cut-off value of 1.5 and (2)).

(A) Differential expression of LOC285758 in individual samples (y-axis presents ΔΔCT values). (B) Comparison of average ΔΔCT values for individual glioma subtype, determined by microarray and qPCR. Oligoastrocytoma samples were not included in microarray analysis. ΔΔCT represents difference of gene’s expression in comparison to brain reference RNA, and the positive values mean that gene’s levels are increased. p-values were determined for qPCR data (ANOVA for comparing all five subtypes and Mann-Whitney U-test for comparing two subtypes).

Scatter plots showing (A)LOC285758 expression (qPCR) in association to methylation status. Unmethylated samples showed higher expression levels compared to methylated ones. (B)LOC285758 expression and promoter methylation status significantly differ regarding the WHO malignancy grade and (C) glioma subtype, especially comparing astrocytoma grade I-III (all samples were methylated) to grade IV (GBMs were largely unmethylated).Promoter methylation: 0 = unmethylated, 1 = methylated

Association of LOC285758 expression with patients demographic data and glioma hallmark biomarkers: mutations of IDH1 and TP53, copy number variations of CDKN2A and CDKN2B, and loss of chromosome arm 1p and 19q (1p/19q co-deletion)

	LOC285758 expression		LOC285758 promoter methylation

	r_s	p-value	r_s	p-value
Gender	-0.044	0.634	0.009	0.920
Age at diagnosis (< 45y >)	0.065	0.475	-0.313	< 0.001
WHO grade (low/high)	0.213	0.019	-0.433	< 0.001
IDH1 (wt/mut)	0.375	< 0.001	0.096	0.331
TP53(wt/mut)	-0.083	0.483	0.153	0.178
1p loss (wt/del)	0.310	0.005	-0.396	< 0.001
19q loss (wt/del)	0.267	0.032	-0.360	0.002
1p/19q loss (wt/del)	0.262	0.014	-0.373	< 0.001
CDKN2A (wt/del)	0.085	0.477	-0.231	0.042
CDKN2B (wt/del)	0.093	0.435	-0.240	0.033

Patients’ demographics and glioma histopathological classification

Patients demographic
Number of patients	157
Gender (female/male)	67/90 (1 : 1.34)
Mean age at diagnosis (years)	43.8 (SD ±18,89)
# < 45 years	86
# > 45 years	71
Glioma classification	Glioma subtype	WHO grade
Astrocytoma (AC)	15 pilocytic	WHO I
	9 diffuse	WHO II
	11 diffuse with signs of anaplasia	WHO II-III
	9 anaplastic	WHO III
	23 secondary GBM	WHO IV
	31 primary GBM	WHO IV
Oligodendroglioma (ODG)	4 diffuse	WHO II
	5 diffuse with signs of anaplasia	WHO II-III
	28 anaplastic	WHO III
Oligoastrocytoma (OAC)	2 diffuse	WHO II
	3 diffuse with signs of anaplasia	WHO II-III
	17 anaplastic	WHO III

Primers used for validation of LOC285758 expression profiling results, reference genes and determining methylation status of lncRNA’s promoter

Quantitative real-time PCR
Gene	Assay ID	Amplicon length (bp)	Annealing temperature (°C)
LOC285758	Hs.PT.58.26012748	129	60
GAPDH	QT00079247	95	55
Gene	Primer sequence (5’ - 3’)	Amplicon length (bp)	Annealing temperature (°C)
U6	CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT	94	60
Methylation sensitive HRM
Gene	Oligonucleotide sequence (5’ – 3’)	Amplicon length (bp)	Annealing temperature (°C)
LOC285758 F	TTGTTTTTTGAAAGTTTTTTGA	118	55
LOC285758 R	AAACACAAAAAACCTAACAAAAA

Top 10 lncRNAs that showed significantly increased/decreased expression in four glioma subtypes, using the LncPath Human Epigenetic Pathway microarray (ArrayStar, USA)

Astrocytoma II+III II+III – tumours of WHO grade II and III; (abs) = absolute value; FC = fold change		Secondary GBM		Primary GBM		Oligodendroglioma

FC(abs)	Gene Name	FC(abs)	Gene Name	FC(abs)	Gene Name	FC(abs)	Gene Name
TOP 10 OVER-EXPRESSED
9.775	RP11-434O22.1	9.840	APOC2	11.343	AK024556	10.085	RP6-201G10.2
7.863	LOC285758	9.105	AK024556	9.761	FJ209302	7.233	LOC285758
6.203	LOC100129034	7.971	LOC100129034	9.402	AK055628	6.241	GAS5
5.247	RP11-264F23.3	7.578	AK055628	9.267	H19	5.454	RP11-264F23.3
5.211	RP6-201G10.2	4.509	RP11-145M9.3	7.012	RP11-434O22.1	5.360	LOC100216546
5.107	APOC2	4.243	RP11-73E17.2	6.720	APOC2	5.043	SNRPE
4.374	RP11-770J1.3	3.657	KB-1836B5.1	5.527	LOC285758	4.991	AK024556
4.211	HOXA11-AS	3.394	H19	4.851	LOC100216546	4.930	AC009506.1
3.861	RP3-405J24.1	2.878	BANCR	4.770	LOC100129034	4.351	RP11-73E17.2
3.795	AK055628	2.695	AB447886	4.525	HOXA11-AS	3.846	LOC286059
TOP 10 UNDER-EXPRESSED
9.638	RP11-678P16.1	24.555	MEG3	22.494	MEG3	43.328	RP11-678P16.1
7.026	XLOC_013368	11.341	AK054921	16.532	AK054921	23.879	FABP5P3
6.797	AK054921	8.050	AF520792	11.157	RP11-678P16.1	18.840	DGCR5
6.148	MEG3	6.845	DGCR5	8.208	DGCR5	8.073	MEG3
6.003	RP11-18F14.2	6.623	XLOC_013368	8.207	XLOC_013368	7.092	AK054921
5.820	HAR1A	6.470	AK054970	7.979	HAR1B	6.887	XLOC_013368
5.052	SNAR-A2	6.243	HAR1A	6.325	HAR1A	6.318	NEAT1
4.216	FABP5P3	6.114	XIST	6.218	SNAR-A2	6.205	SEPT7P6
4.082	RP11-325F22.4	5.799	MIAT	6.066	RP11-208G20.2	6.090	CASC2
3.887	SEPT7P6	5.712	SNAR-A2	5.652	XLOC_008014	5.873	TMSB10P2

Expression of LOC285758, a potential long non-coding biomarker, is methylation-dependent and correlates with glioma malignancy grade

Figures & Tables

Figure 1

Figure 2

Figure 3

Association of LOC285758 expression with patients demographic data and glioma hallmark biomarkers: mutations of IDH1 and TP53, copy number variations of CDKN2A and CDKN2B, and loss of chromosome arm 1p and 19q (1p/19q co-deletion)

Patients’ demographics and glioma histopathological classification

Primers used for validation of LOC285758 expression profiling results, reference genes and determining methylation status of lncRNA’s promoter

Top 10 lncRNAs that showed significantly increased/decreased expression in four glioma subtypes, using the LncPath Human Epigenetic Pathway microarray (ArrayStar, USA)

Paradigm

My account