Have a personal or library account? Click to login

Application of multiplex PCR for the simultaneous detection of Taenia spp. from domestic dogs in the north of Iran

Open Access
|Jul 2016

Figures & Tables

Fig. 1

Status of Mazandaran province in Iran
Status of Mazandaran province in Iran

The applied primers characteristics for multiplex PCR

ParasiteTargetNamePrimer sequence (5′-3′)Amplicon size (bp)
E. multilocularisnadlCestiTGCTGATTTGTTAAAGTTAGTGATC395 bp
Cest2CATAAATCAATGGAAACAACAACAAG
E. granulosusrrnSCest4GTTTTTGTGTGTTACATTAATAAGGGTG117 bp
Cest5GCGGTGTGTACMTGAGCTAAAC
Taenia spp.rrnSCest3YGAYTCTTTTTAGGGGAAGGTGTG267 bp
Cest5GCGGTGTGTACMTGAGCTAAAC

Prevalence of infectivity of domestic dogs in north of Iran using multiplex PCR from DNA of taeniid eggs from faecal samples according to sex and age (N=100)

InfectionSexAgeTotal(n: 100)
Male(n: 56)Female(n: 44)12 month> (n: 21)12 month ≤(n: 79)
E. granulosus8.9 % (5)15.9 % (7)14.2 % (3)11.3 % (9)12 % (12)
Taenia spp.12.5 % (7)6.8 % (3)9.5 % (2)10.1 % (8)10 % (10)
E. multilocularis00000
Mixed infection(E. granulosus and Taenia spp.)3.5 % (2)04.7 % (1)1.2 % (1)2 % (2)
p value>0.05>0.05
Total24.9 % (14)22.7 % (10)27.4 % (6)22.6 % (18)24 % (24)
DOI: https://doi.org/10.1515/helmin-2016-0017 | Journal eISSN: 1336-9083 | Journal ISSN: 0440-6605
Language: English
Page range: 285 - 289
Submitted on: Sep 6, 2015
Accepted on: Mar 23, 2016
Published on: Jul 22, 2016
Published by: Slovak Academy of Sciences, Mathematical Institute
In partnership with: Paradigm Publishing Services
Publication frequency: 4 times per year

© 2016 M.T. Rahimi, S. Sarvi, A. Daryani, M. Sharif, E. Ahmadpour, A. Shokri, A. Mizani, published by Slovak Academy of Sciences, Mathematical Institute
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.