Introduction
The genus Xiphinema Cobb, 1913 belonging to the family Longidoridae represents ectoparasitic root nematodes commonly known as the dagger nematode. There are approximately 260 nominal species in the genus to date (Gutiérrez-Gutiérrez et al., 2012). They are typically divided into two groups, namely X. americanum-group with about 50 species and non-X. americanum-group (Loof & Luc, 1990; Lamberti et al., 2000). The genus Xiphinema includes phytopathogenic species that damage a large number of wild and cultivated plants through direct feeding on root cells and transmission of several plant-pathogenic viruses (Taylor & Brown, 1997). It is of economic importance on grape, strawberry, hops, fruit trees and other crops. Nine species of Xiphinema have been shown to transmit nepoviruses (Decraemer & Robbins, 2007). Some species in the X. americanum-group can serve as vectors of several important plant viruses including Tabacco ringspot virus, Tomato ringspot virus, Cherry rasp leaf virus and Peach rosette mosaic virus that damage a wide range of crops (Taylor & Brown, 1997). Several species in the group are listed as quarantine organisms by some countries or regions such as the European and Mediterranean Plant Protection Organization. Therefore, accurate identification of the genus to the species level is crucial to implement appropriate control measures for these nematodes.
Currently, species identification of this genus is mainly based on morphological features and morphometrics. However, species belonging to Xiphinema americanum-group show conserved morphology and overlapping morphometrics (Coomans et al., 2001; Gutiérrez-Gutiérrez et al., 2012). Thus, DNA-based approaches including ribosomal DNA such as the 18S, D2-D3 expansion segments of 28S, ITS regions, and mitochondrial DNA have been employed for the molecular characterization and reconstruction of phylogenetic relationships within Xiphinema (Oliveira et al., 2004; Ye et al., 2004; He et al., 2005; Lazarova et al., 2006; Wu et al., 2007; Gutiérrez-Gutiérrez et al., 2012, 2013).
Some species of the genus Xiphinema are distributed worldwide, whereas others have limited distribution (Coomans, 1996; Coomans et al., 2001; Gutiérrez-Gutiérrez et al., 2012). So far, 14 species of Xiphinema (X. americanum Cobb, 1913, X. brasilienseLordello, 1951, X. brevicolleLordello & Costa, 1961, X. diffusum Lamberti & Blève-Zacheo, 1979, X. elongatum Schuurmans Stekhoven & Teunissen, 1938, X. hunanienseWang & Wu, 1992, X. imitator Heyns, 1965, X. incognitum Lamberti & Blève-Zacheo, 1979, X. insigne Loos, 1949, X. luci Lamberti & Bleve-Zacheo, 1979; X. oxycaudatum Lamberti & Blève-Zacheo, 1979, X. radicicola Goodey, 1936, X. taylori Lamberti, Ciancio, Agostinelli & Coiro, 1992, X. thornei Lamberti & Golden, 1986) were reported in China (Luo et al., 2001; Pan et al., 2000; Teng et al., 2013; Wang et al., 1996; Wu, 2007; Xu et al., 1995; Zheng & Brown, 1999).
During a survey of nematode biodiversity in Yangmeikeng and Tianxinshan environmental monitoring sites in Shenzhen, China in 2012 – 2014, ten Xiphinema populations (designated as SZX1301 – SZX1310) were recovered from the rhizosphere collected from five plant species including Blechnoid (Blechnum orientale L.), Awn dichotoma (Gleichenia linearis Clarke.), Lychee (Litchi chinensis Sonn.), Acacia acacia (Acacia mangium Willd.) and Taiwan acacia (A. confusa Merr.).
The main objectives of this study were to: (i) identify the species of ten Xiphinema populations based on morphological and molecular approaches; and (ii) investigate their phylogenetic relationships with other species in the genus based upon sequence analysis of the 28S D2-D3 rDNA.
Materials and Methods
Sampling and Morphological Study
Soil samples were collected from the rhizosphere at a depth of 15 – 30 cm of different plants, namely Acacia acacia, Taiwan acacia, Blechnoid, Lychee in Tianxinshan and Awn dichotoma in Yangmeikeng environmental monitoring sites. Ten nematode populations from the rhizosphere of five plants in two environmental monitoring sites, Shenzhen, China, were presented in Table 1. Nematodes were extracted by a sieving and decanting method (Brown & Boag, 1988). Specimens were heat-killed, fixed in 3 % formaldehyde and processed to glycerin by the formalin-glycerin method (Hooper, 1970; Golden, 1990). Specimen preparation and measurements were as described in Golden & Birchfield (1972). Measurements of nematodes were performed with the aid of a camera lucida and a stage micrometer. The morphometric data were processed using Excel software (Ye, 1996). Photomicrographs were taken with a Leica video camera (DFC490) fitted on a Leica microscope (DM4000B), and edited using Adobe Photoshop CS5. Morphological identification of specimens for Xiphinema was done using the polytomous keys provided by Lamberti et al. (2000, 2004) and Loof & Luc (1990), with corresponding species descriptions.
Molecular Study
DNA extraction, amplification and sequencing For each population, three females were hand-picked into distilled water for DNA extraction, amplification, and sequencing. They were placed into 50 μl of worm lysis buffer (WLB) containing Proteinase K for DNA extraction (Williams et al., 1992). DNA samples were stored at –20°C until used as a PCR template.
The primers for small subunit 18S amplification and DNA sequencing were forward primer 18S965 (5’ GGCGATCAGATAC CGCCCTAGTT 3’) and reverse primer 18S1573R (5’ TACAAAGGGCAGGGACGTAAT 3’) (Mullin et al., 2005). Primers for large subunit 28S amplification and DNA sequencing were forward primer D2a (5’ ACAAGTACCGTGAGGGAAAGTTG 3’) and reverse primer D3b (5’ TGCGAAGGAACCAGCTACTA 3’) (Nunn, 1992). The 25 μl PCR was performed using TaqMix DNA polymerase (Guangzhou Dongsheng Biotech Ltd., Guangzhou, China) according to the manufacturer’s protocol. The thermal cycler program for PCR was as follows: denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 94 °C with 30 s; annealing at 55 °C for 45 s, and extension at 72 °C for 2 min. A final extension was performed at 72 °C for 10 min (Ye et al., 2007).
Table 1.
Species and populations of Xiphinema in this study
| Species | Population code | Locality | Host plant | 18S Accession No. | 28S D2-D3 Accession No. |
|---|---|---|---|---|---|
| Xiphinema hunaniense | SZX1301 | Tianxinshan, Shenzhen | Blechnum orientale | KP79303 | KP793046 |
| Xiphinema hunaniense | SZX1302 | Tianxinshan, Shenzhen | Blechnum orientale | KP793037 | KP793047 |
| Xiphinema hunaniense | SZX1303 | Yangmeikeng, Shenzhen | Gleichenia linearis | KP793038 | KP793048 |
| Xiphinema hunaniense | SZX1304 | Tianxinshan, Shenzhen | Litchi chinensis | KP793039 | KP793049 |
| Xiphinema brasiliense | SZX1305 | Yangmeikeng, Shenzhen | Gleichenia linearis | KP793040 . | KP793050 |
| Xiphinema americanum s.l | . SZX1306 | Tianxinshan, Shenzhen | Acacia mangium | KP793041 | KP793051 |
| Xiphinema americanum s.l | . SZX1307 | Tianxinshan, Shenzhen | Blechnum orientale | KP793042 | KP793052 |
| Xiphinema americanum s.l | .SZX1308 | Tianxinshan, Shenzhen | Blechnum orientale | KP793043 | KP793053 |
| Xiphinema americanum s.l | . SZX1309 | Tianxinshan, Shenzhen | Acacia confuse | KP793044 | KP793054 |
| Xiphinema americanum s.l | . SZX1310 | Tianxinshan, Shenzhen | Litchi chinensis | KP793045 | KP793055 |
PCR products were cleaned using an EZ Spin Column DNA Gel Extraction Kit (Bio Basic Inc., Markham, Ontario, Canada) according to the manufacturer’s protocol before being sequenced by Shanghai Sangon Biological Engineering Technology and Service Co., Ltd. (Shanghai, China) using an ABI PRISM 3730 sequencing system.
Phylogenetic analysis: The nematode sequences from this project were deposited in GenBank. We used DNA sequences with the highest matches with our populations from the GenBank database for phylogenetic analysis. DNA sequences were aligned using ClustalW (http://workbench.sdsc.edu, Bioinformatics and Computational Biology Group, Department of Bioengineering, UC San Diego, San Diego, CA, USA). The model of base substitution in the 28S rDNA sets was evaluated using MODELTEST version 3.06 (Posada & Crandall, 1998). The Akaike-supported model (GTR), the proportion of invariable sites (I), and the gamma distribution shape parameters and substitution rates (G) were used in phylogenetic analyses. Bayesian analysis was performed to confirm the tree topology for each gene separately using MrBayes 3.1.0 (Huelsenbeck & Ronquist, 2001) running the chain for 106 generations and setting the ‘burn in’ at 1000. We used MCMC (Markov Chain Monte Carlo) methods within a Bayesian framework to estimate the posterior probabilities of the phylogenetic trees (Larget & Simon, 1999) using the 50 % majority-rule.
Results
Through this study, four nematode populations (SZX1301 – SZX1304) were identified as Xiphinema hunaniense, one population (SZX1305) as X. brasiliense, and five populations (SZX1306 – SZX1310) as X. americanum s.l. (Table 1), representing the first report of these three species from the above-mentioned plant hosts except for lychee.
Morphological description
Morphometrics of females of ten populations of Xiphinema are presented in Table 2. Four populations (SZX1301 – SZX1304) of X. hunaniense are identical each other. All five populations of X. americanum s.l. (SZX1306 – SZX1310) showed little variation at morphometrics and molecular characteristics, thus considered different geographical populations belonging to the same species. Xiphinema hunanienseWang & Wu, 1992 (Fig. 1, Tables 1 & 2) Female: Body 1810 – 2400 μm long, tapering slightly towards anterior and tail region, posterior end arcuate ventrally when heat-killed. Body cuticle smooth. Lip region 10 – 12 μm in diam., slightly offset from body profile. Amphids stirrup-shaped, with slitlike apertures. Stylet 173 – 193 μm long. Guide ring 86 – 108 μm from anterior end. Pharynx typical of genus. Vulva a transverse slit, anterior, occupies 23 % – 28 % of total body length, vagina thick-walled, occupying up to 50 % of body width. Reproductive system monodelphic, with a posterior reflexed gonad. Uterus short and undifferentiated, “Z”-organ absent. Tail dorsally conoid, slightly convex dorsally and concave ventrally, with a digitate, elongated peg (11 – 20 μm long), with three caudal pores on each side of tail (one on each at beginning of tail terminus, the other two on the dorsal side near anus).
Table 2.
Morphometrics of females of Xiphinema spp. populations mounted in formalin–glycerin in this study. All measurements in μm and in the format: mean ± s.d. (Range)
| X hunaniense | X hunaniense | X hunaniense | X hunaniense | X brasiliense | X americanum s.l. | X americanum s.l. | X americanum s.l. | X americanum s.l. | X americanum s.l. | |
|---|---|---|---|---|---|---|---|---|---|---|
| SZX1301 | SZX1302 | SZX1303 | SZX1304 | SZX1305 | SZX1306 | SZX1307 | SZX1308 | SZX1309 | SZX1310 | |
| Host | Blechnum orientate | Blechnum orientate | Gleichenia linearis | Litchi chinensis | Gleichenia linearis | Acacia mangium | Blechnum orientate Blechnum orientate | Acacia confusa | Litchi chinensis | |
| n | 10 | 10 | 10 | 10 | 5 | 10 | 10 | 10 | 10 | 10 |
| L | 2098.8 ±96.1 (1989.6-2200.0) | 2236.4 ±176.9 (2001.8-2400.0) | 2110.5 ± 100.0 (1998.7-2202.7) | 2018.6 ±141.1 (1810.0-2179.3) | 1643.1 ±346.8 (1108.0-2100.0) | 1792.6 ±80.7 (1669.0-1888.0) | 1808.6 ±86.7 (1691.0-1904.0) | 1876.1 ± 144.7 (1696.0-2105.6) | 1785.6 ± 116.2 (1643.8-1932.0) | 1807.5 ±94.8 (1683.0-1909.0) |
| a | 42.1 ±3.4 (39.7-48.0) | 46.9 ± 4.3 (42.5-52.7) | 46.8 ±3.1 (43.0-50.1) | 46.2 ± 2.5 (43.0-49.1) | 38.4 ±5.5 (30.0-47.9) | 45.1 ± 1.0 (43.8-46.2) | 45.6 ± 1.0 (44.5-47.1) | 46.8 ±4.1 (38.1-50.1) | 46.6 ±2.2 (44.7-50.4) | 44.7 ±2.1 (41.0-46.0) |
| b | 5.9 ±0.3 (5.6-6.4) | 6.1 ±0.2 (5.9-6.5) | 6.0 ±0.2 (5.9-6.3) | 5.6 ±0.5 (5.0-6.1) | 5.5 ± 0.3 (5.2-6.0) | 6.8 ±0.4 (6.1-7.2) | 6.7 ±0.6 (5.9-7.3) | 6.7 ±0.6 (5.9-7.7) | 6.6 ±0.4 (6.1-7.0) | 6.4 ±0.7 (5.3-7.0) |
| c | 45.9 ± 5.7 (38.0-51.6) | 48.0 ±3.8 (41.7-51.0) | 40.4 ±3.8 (37.1-46.8) | 39.9 ±2.2 (37.6-43.0) | 41.6 ±2.8 (39.0-48.1) | 63.0 ±5.8 (57.4-69.4) | 64.1 ±9.8 (56.2-78.7) | 68.3 ±10.3 (56.3-84.9) | 64.5 ±9.1 (56.1-76.7) | 64.3 ± 4.0 (58.1-69.2) |
| c’ | 1.6 ± 0.1 (1.5-1.7) | 1.6 ± 0.1 (1.6-1.7) | 1.9 ±0.3 (1.7-2.3) | 2.1 ±0.4 (1.7-2.6) | 1.2 ± 0.1 (1.0-1.3) | 1.1 ±0.1 (1.0-1.4) | 1.1 ±0.1 (0.9-1.2) | 1.1 ±0.2 (0.9-1.3) | 1.1 ±0.1 (1.0-1.2) | 1.1 ±0.1 (1.0-1.3) |
| V | 27.6 ±0.4 (27.0-28.0) | 26.9 ±0.8 (26.0-27.8) | 26.0 ± 1.6 (23.3-27.2) | 26.8 ±0.8 (26.0-28.0) | 27.3 ±1.0 (26.0-29.0) | 51.8 ± 1.7 (50.3-54.5) | 52.4 ± 1.5 (50.9-54.7) | 51.9 ± 1.1 (50.6-53.2) | 52.5 ±1.6 (50.8-54.5) | 52.7 ±0.9 (51.6-53.9) |
| Odontostyle | 121.1 ±4.6 (116.8-128.6) | 120.6 ±4.2 (116.9-127.7) | 114.0 ±3.1 (109.0-117.2) | 115.2 ±3.7 (110.3-119.0) | 123.8 ±4.9 (116.0-132.0) | 89.0 ± 1.0 (87.9-90.2) | 93.1 ±3.0 (89.8-95.9) | 94.8 ±7.5 (82.7-107.6) | 89.0 ±2.4 (85.9-92.3) | 92.5 ± 4.0 (88.5-97.2) |
| Odontophore | 66.9 ±3.5 (63.8-71.3) | 65.1 ±0.7 (64.2-66.2) | 70.3 ±1.0 (68.9-71.4) | 64.3 ± 4.9 (60.0-70.0) | 69.5 ± 4.8 (65.0-80.0) | 50.4 ±1.5 (48.9-52.3) | 52.0 ±1.7 (49.7-53.8) | 53.2 ±2.4 (49.6-58.0) | 51.0 ±1.6 (48.9-53.2) | 51.1 ±2.7 (48.7-55.6) |
| Onchiotyle | 187.9 ±4.6 (181.8-192.9) | 185.7 ±4.2 (182.2-192.9) | 184.3 ±3.9 (177.9-188.2) | 179.5 ±5.9 (172.7-189.0) | 193.3 ±9.3 (182.0-212.0) | 139.5 ±2.3 (136.9-142.5) | 145.0 ±4.6 (139.8-149.6) | 142.4 ±7.0 (132.3-150.3) | 140.0 ±3.4 (136.8-145.5) | 143.7 ±6.2 (137.2-152.8) |
| Tail | 46.5 ±7.2 (40.2-55.9) | 46.6 ±2.1 (44.0-49.0) | 52.7 ± 6.8 (42.9-59.3) | 50.8 ±5.9 (44.2-57.9) | 39.7 ±8.9 (26.9-51.0) | 28.6 ±2.2 (26.0-31.9) | 28.7 ±3.8 (24.2-32.6) | 27.8 ±3.2 (23.9-33.2) | 28.0 ± 2.8 (25.1-31.5) | 28.2 ± 2.5 (26.3-32.6) |
| Width at lip | 11.0 ±0.8 (10.0-12.0) | 10.9 ±0.6 (10.0-11.5) | 10.5 ±1.0 (9.7-12.0) | 10.5 ±0.5 (10.0-11.0) | 11.2 ± 0.9 (10.0-12.6) | 10.6 ±0.4 (10.0-11.0) | 10.6 ±0.4 (10.0-11.0) | 10.6 ±0.4 (10.0-11.2) | 10.6 ±0.4 (10.0-11.0) | 10.6 ±0.4 (10.0-11.0) |
| Width at mid. body | 50.1 ±4.6 (44.3-55.0) | 47.9 ± 4.8 (43.8-56.1) | 45.2 ±1.3 (44.0-46.7) | 43.6 ±0.9 (42.1-44.4) | 43.0 ±8.7 (32.2-60.0) | 39.7 ±2.4 (36.2-42.0) | 39.7 ±1.3 (38.0-41.5) | 40.5 ±6.0 (34.9-55.2) | 38.4 ±3.7 (33.7-43.2) | 40.5 ±1.5(38.9-42.9) |
| Width at anus | 28.6 ±3.2 (25.3-32.9) | 28.8 ±1.1 (27.4-30.0) | 27.3 ± 3.4 (23.8-32.4) | 24.8 ±3.0 (22.1-29.6) | 33.8 ±8.3 (23.4-46.7) | 25.2 ±0.5 (24.5-25.7) | 25.4 ±1.2 (23.5-26.4) | 25.4 ±1.7 (23.2-27.9) | 25.6 ± 0.8 (24.6-26.5) | 25.3 ±3.1 (22.3-29.5) |
| Pharynx | 355.9 ± 25.2 (332.0-386.7) | 367.3 ±21.0 (339.3-388.8) | 350.1 ± 16.8 (329.3-372.4) | 360.3 ± 33.8 (312.1-401.6) | 301.5 ±65.2 (205.2-375.0) | 264.1 ±22.6 (238.3-300.5) | 273.5 ± 28.6 (239.7-304.0) | 280.6 ±24.1 (242.4-322.8) | 271.3 ±29.7 (241.0-304.0) | 283.8 ±31.9(247.5-333.3) |
| Oral aperture to ring guide | 101.5 ± 3.4 (98.0-106.7) | 102.5 ±4.8 (97.3-108.2) | 94.1 ±5.7 (85.5-100.0) | 97.5 ±1.3 (95.9-99.3) | 115.1 ±3.7 (109.2-120.0) | 74.6 ±2.7 (72.7-79.4) | 78.3 ± 4.8 (72.0-84.5) | 79.7 ± 4.2 (71.6-86.9) | 73.8 ± 2.6 (70.9-76.7) | 74.7 ± 8.0 (69.3-88.9) |

Fig. 1.
Light micrographs of Xiphinema hunaniense from Blechnum orientale. A: Female entire body; B: Female anterior body; C: Reproductive system of female (in ventral view); D: Female tail (in ventral view); E: Female tail (in lateral view). Scale bars: A = 50 μm; B – E = 10 μm
Male: Not found.
The morphology and morphometrics of four studied populations (SZX1301 – SZX1304) of X. hunaniense agreed with the description of type populations except for a lower a (39.7 – 52.7 vs 51.0 – 57.0) and c (37.1 – 51.6 vs 53.0 – 63.0) values (Wang & Wu, 1992). A revised polytomous key code sensu Loof & Luc (1990) for X. hunaniense identification is: A1-B4-C4-D4-E1-F2-G2-H2-I3-J4-K2-L1.
Xiphinema brasiliense Lordello, 1951

Fig. 2.
Light micrographs of female Xiphinema brasiliense from Gleichenia linearis. A, B: Entire body; C: Anterior body; D: Tail in ventral view; E: Tail in lateral view; F: Reproductive system. Scale bars: A = 500 μm; B, C, E = 20 μm; D = 10 μm
Female: Body 1108-2100 μm long, cylindrical, straight or ventrally arcuate to form an open “C” shape when heat-killed. Lip region continuous with the rest of the body or offset from body profile by a depression. Stylet 182 – 212 μm long. Guide ring 109 – 120 μm from anterior end. Reproductive system monodelphic, with an anterior reflexed gonad. Vulva anteriorly located at 26 % – 29 % of total body length, vagina 1/3 to 1/2 body diam. long, posteriorly obliquely bent. Tail broadly conoid ending with a well-developed axial peg, 8 – 12 μm long. Four caudal pores present on each side of tail.
Male: Not found.
Xiphinema brasiliense population (SZX1305) agreed with type (Lordello, 1951) and other populations (Cordero, 2003), except for a higher b and c value (5.50 vs 5.05 and 41.60 vs 24.55) (Lordello, 1951), but lie within the ranges of those reported by Cordero (2003). A revised polytomous key code sensu Loof and Luc (1990) for X. brasiliense identification is: A1-B4-C5-D5-E1-F2-G2(3)-H1(2)-I3-J5-K?-L1.
Xiphinema americanum s.l. Cobb, 1913

Fig. 3.
Light micrographs of female Xiphinema americanum s.l. from Acacia mangium. A: Entire body; B: Anterior body; C: Reproductive system; D: Vulva (in ventral view); E: Tail in lateral view; F: Tail in ventral view. Scale bars: A = 100 μm; B – F = 20 μm
Female: Body 1644 – 2110 μm in length, cylindrical, tapering gradually towards the anterior extremity, and more abruptly posteriorly in the tail region, ventrally arcuate to form a closed “C” shape when heat-killed. Cuticle finely transversely striated. Lip region broadly rounded, set off from the rest of body by a depression, 10 – 11 μm in diam. Amphids large, stirrup-shaped, with wide aperture, as a straight transverse slit. Stylet 132 – 153 μm long, basal flanges 7.5 – 9.5 μm wide. Guiding ring 69 – 89 μm from anterior end. Pharynx dorylaimoid with the anterior part tubular, bearing a strongly refringent mucro at 48 – 54 μm from the base of the odontophore, pharyngeal basal bulb containing three nuclei, nucleus of dorsal pharyngeal gland located at 25 % of the length from the beginning of basal bulb, and two ventro-sublateral nuclei situated at 50 % of the bulb. Oesophago-intestinal valve heart-shaped. Reproductive system amphidelphic with reflexed branches about equally developed. Vulva slit-like, situated in mid-body region. Vagina 11 – 15 μm in length, occupying about 1/3 of the corresponding body diam., pars proximalis vaginae 5 – 6 μm long, pars distalis vaginae 7 – 10 μm long. Uteri long, 35 – 45 μm, not clearly separated from the oviduct, without spermatheca. Rectum length 1/2 of the body diam. at anus. Tail short conoid, with rounded terminus and four lateral pores.
five studied populations were classified as X. americanum s.l. due to limited diagnostic morphological characters and DNA data.
The codes of the Chinese Xiphinema americanum s.l. populations and close species using both X. americanum-group polytomous identification keys (Lamberti et al., 2000; Lamberti et al., 2004) were presented in Tables 3, 4. The codes of the Chinese X. americanum s.l. populations are: A2, B2, C2, D1, E1(2), F1, G2, H2(3), I2, J2 sensu Lamberti et al. (2000) and A3(4), B2, C2, D2, E2, F1, G2, H2, I2 sensu Lamberti et al. (2004). Further, after sorting the codes with other data in the keys the Chinese populations showed identical numbers to some other species in X. americanum-group.
Table 3.
The codes of the Chinese Xiphinema americanum s.l. populations and the close species in X. americanum-group sensu Lamberti et al. (2000)
| Species/Codes | A | J | C | H | В | D | Е | F | G | I |
|---|---|---|---|---|---|---|---|---|---|---|
| X. americanum s.l. | 2 | 2 | 2 | 2(3) | 2 | 1 | 1(2) | 1 | 2 | 2 |
| X. taylori | 2 | 2 | 2 | 3(2) | 3(2) | 1 | 1 | 1(2) | 2 | 2(1) |
| X. diffusum | 2 | 2 | 2(1) | 2(1) | 2 | 1 | 1 | 1 | 2 | 1(2) |
| X. incognitum | 2 | 2 | 2(1) | 2(3) | 2(3) | 1(2) | 1 | 1 | 2(1) | 2 |
| X. brevicolle | 2 | 2 | 3(2) | 3 | 3(2) | 1 | 2(3(1) | 1 | 2 | 2(1) |
| X. parabrevicolle | 2 | 2 | 3(2) | 3 | 3(2) | 1 | 2(1) | 1 | 2 | 1(2) |
Table 4.
The codes of the Chinese Xiphinema americanum s.l. populations and X. incognitum and X. brevicolle sensu Lamberti et al. (2004)
| Species/Codes | G | H | A | C | B | D | E | F | I |
|---|---|---|---|---|---|---|---|---|---|
| X. americanum s.l. | 2 | 2 | 3(4) | 2 | 2 | 2 | 2 | 1 | 2 |
| X. incognitum | 2 | 2 | 3 | 2 | 2 | 2 | 2 | 1 | 2 |
| X. brevicolle | 2 | 2 | 5 | 1 | 2 | 23 | 23 | 1 | 12 |
Molecular Phylogenetic Relationships
The 18S rDNA (633 – 796 bp) and 28S D2–D3 expansion segment (773 – 860 bp) were amplified and sequenced. Sequences of the rDNA were compared using blastN search from a diverse collection of Xiphinema species from GenBank and were used to construct phylogenetic trees with highest match sequences.
The alignment for the partial 18S rDNA included 67 sequences. Four studied populations (KP793036 – KP793039) of X.
Male: Not found.
A morphometric analysis of five studied populations of X. americanum s.l. (SZX1306 – SZX1310) revealed that specimens from these populations differed from Cobb’s paratypes of the X. americanum by having a longer body (1644 – 2106 vs 1400 – 1500 μm), a lower a value (38 – 50 vs 50 – 57), a higher c value (56 – 85 vs 45 – 54), a lower c’ value (0.9 – 1.4 vs 1.7 – 2.0), a longer odontostyle (83 – 108 vs 65 – 73 μm), a longer odontophore (49 – 58 vs 41 – 46 μm) and a more posterior guide ring (71 – 89 vs 51 – 55 μm) (Lamberti & Golden, 1984), from X. incognitum by having a smaller lip (10.0 – 11.2 vs 11.0 – 13.0 μm), from X. diffusum by having a smaller lip (10.0 – 11.2 vs 11.0 – 13.0 μm), a more posterior guide ring (69.3 – 88.9 vs 60.0 – 64.0 μm), from X. taylori by having a shorter (1644 – 2106 vs 2100 – 2500 μm), a higher c’ value (0.9 – 1.4 vs 0.7 – 0.8) and a longer tail (23.9 – 33.2 vs 19.5 – 22.0 μm), from X. parabrevicolle by having a higher c’ value (0.9 – 1.4 vs 0.7 – 0.8), a smaller lip (10.0 – 11.2 vs 12.5 – 14.0 μm) (Gutiérrez-Gutiérrez et al. 2012), from X. brevicolle by having a shorter stylet (137 – 143 vs 144 – 173 μm) (Lordello & Costa 1961; Lamberti et al. 1991; Luc et al. 1998), a lower b value (5.3 – 7.7 vs 7.0 – 10.5) (Lordello & Costa 1961). Nevertheless, these hunaniense from China had 100 % identities (647/647=100 %) based on alignments of the sequences of 18S rDNA. No 18S sequence of X. hunaniense was available for comparison in Gen-Bank. Alignment of the 18S sequences from the studied population (KP793040) of X. brasiliense from China with one Brazil population of X. brasiliense (AY297836) from GenBank revealed 99 % identity (688/694=99 %). The sequences of 18S rDNA from five studied populations (KP793041 – KP793045) of X. americanum s.l. from China shared 100 % identities (633/633=100 %). These sequences are also identical to four other populations from Brazil (AY297822), Czech Republic (HM163212), Belgium (AY580057) and Japan (AB604340). However, the sequenced 18S fragments are only 633 – 796 bp without sufficient divergent sites to examine the phylogenetic relationships among dagger species, no significant clades were generated with strong support, thus the 18S tree is presented. The alignment for the D2–D3 of 28S rDNA included 93 sequences. The sequences of 28S rDNA from four studied populations (KP793046 – KP793049) of X. hunaniense shared 99 % identities with 2 nucleotide differences. The alignment of the 28S sequences from these four studied populations with other five populations of X. hunaniense (EF026090, EF188839, EF188840, EF188841, KF290564) from GenBank revealed 98 % – 99 % identities with 6 – 14 nucleotide differences. The blastn search of the 28S sequence of the Chinese population (KP793050) of X. brasiliense revealed a 99 % match (763/766=99 %, 3 nucleotide differences) with one Brazilian population of X. brasiliense (AY601616) from GenBank. Five studied populations (KP793051 – KP793055) of X. americanum s.l. shared 99 % – 100 % identities with 0 – 9 nucleotide differences. The alignment of the 28S sequences from these five studied populations with 11 populations of X. brevicolle (AB635401, AB675667, AB675668, AY580057, AY601601, AY601604, AY601605, FM211649, HM163209, HQ184473, KF430800) and some other species such as X. lambertii (HM163211), X. diffusum (AY601600), X. taylori (AY601602), etc. from GenBank revealed 98 % – 99 % identities with 10 – 20 nucleotide differences.
The phylogenetic tree inferred from D2–D3 of the 28S rDNA (Fig. 4) using Longidorus vineacola Ye & Robbins, 2003 and L. helveticus Lamberti, Kunz, Grunder, Molinari, De Luca, Agrostinelli & Radicci, 2001 as outgroups suggested that: i) all the selected xiphinematids are in a monophyletic clade in relation to L. vineacola with 100 % pp; ii) two distinct clades of Xiphinema species are highly supported (pp=100 %), representing X. americanum-group and non-X. americanum-group. In X. americanum-group, seven populations (HM921393, HM921356, KJ802889, JQ990031, JQ990032, JQ990036, JQ990040) are in a clade and 35 other populations including five studied ones of X. americanum s.l. (KP793051 – KP793055) are in another clade with 100 % support; iii) five studied populations of X. americanum s.l. are in a monophyletic clade with 100 % support, and are in a highly-supported (pp=100 %) monophyletic clade with 16 other populations of Xiphinema, and they are sister to X. parabrevicolle (JQ990042); iv) four studied populations of X. hunaniense (KP793046 – KP793049) and the population of X. brasiliense (KP793050) are clustered with other members of non-X. americanum-group, and these two species are in two separate clades; v) four studied populations of X. hunaniense are in a highly-supported (pp=100 %) monophyletic clade with five other populations of X. hunaniense (EF026090, EF188839, EF188840, EF188841, KF290564) from GenBank, and they are sister to X. lupini (KC567183, HM921352) and X. turcicum (KC567185); v) the studied population X. brasiliense (KP793050) is in a highly-supported (pp=100 %) clade with the Brazilian population of X. brasiliense (AY297836), and they are in a highly-supported (pp=100 %) clade with 12 other species (X. nuragicum, X. pyrenaicum, X. hispanum, X. adenohystherum, X. sphaerocephalum, X. italiae, X. zagrosense, X. granatum, X. cohni, X. gersoni, X. israeliae, X. barense) from GenBank.

Fig. 4.
The 10001st Bayesian tree inferred from Xiphinema spp. 28S D2-D3 under GTR+I+G model (-lnL=10448.2939; AIC=20916.5879; freqA=0.2519; freqC=0.2207; freqG=0.3013; freqT=0.2261; R(a)=0.9498; R(b)=2.5514; R(c)=2.4833; R(d)=0.5243; R(e)=4.4187; R(f)=1; Pinva=0.3354; Shape=0.8037). Posterior probability values exceeding 50% are given on appropriate clades
Discussion
Species identification on Xiphinema americanum-group is difficult or even impossible due to conservative and overlapping morphological and morphometric characters. This group may contain many cryptic species that are morphologically indistinguishable but may be phylogenetically distant to one another (Gutiérrez-Gutiérrez et al. 2010, 2012; Barsi & De Luca 2008; Oliveira et al. 2005, 2006; Wu et al. 2007; Ye et al. 2004). In the present study, analysis of morphology and morphometrics indicated that five studied populations (SZX1306 – SZX1310) were very similar to some members belonging to X. americanum-group. The codes of these five populations using polytomous identification keys revealed identical numbers to some other species in this group such as X. incognitum (Tables 3, 4). Molecular analysis based on D2–D3 of 28S rDNA sequences revealed that these five studied populations and other members within X. americanum-group such as X. brevicolle show high similarity. Thus, these five studied populations were classified as X. americanum s.l.. Compared with X. incognitum from Fujian (Wu 2007) and Japan (Shishida 1983), a closest species to the Chinese X. americanum s.l., no obvious morphometrics difference was found. The identification codes of these two species revealed identical numbers. However, 28S rDNA sequence alignment of five populations of the Chinese X. americanum s.l. with an American population (AY601597) of X. incognitum in GenBank revealed 96 % identity with 27 nucleotide differences. In addition to D2–D3 of 28S rDNA, other molecular markers, such as ITS-rRNA and the protein-coding mitochondrial gene, cytochrome oxidasec subunit I (COI) were successfully used for diagnosis and reconstruction of phylogenetic relationships within some species of X. americanum-group (Gutiérrez-Gutiérrez et al. 2012; Lazarova et al., 2006). In the future, sequencing these markers on five studied populations of X. americanum s. l. will help to characterize this species and investigate its phylogenetic relationship with other sequenced dagger species.
Morphological intraspecific variation in dagger nematodes from different geographic locations is common (Tarjan, 1969; Brown & Topham, 1985; Cho & Robbins, 1991). In the present study, no obvious differences were found in morphological and morphometric characters amongst four populations of X. hunaniense (SZX1301 – SZX1304) and amongst five studied populations of X. americanum s.l. from two sites and five plants. This is largely due to the sampling being from the same sites, the same city or the same hosts; for example, two populations (SZX1301 & SXZ1302) of X. hunaniense were from the same host (B. orientale) in different spots of the same site (Tianxinshan), so were X. americanum s.l. populations, SZX1307 and SXZ1308 (Table 1). Compared with other populations, most of the morphological characteristics from populations of X. hunaniense fit within the ranges of previous reports (Wang & Wu, 1992; Robbins & Wang, 1998; Zheng & Brown, 1999). The minor differences were only present in a few characters such as a 72 and c values. However, the molecular data confirmed identity of this species. Morphometrics of the studied X. brasiliense population agreed with those of type population except for b and c values, but the analysis of the 28S D2–D3 rDNA sequences revealed their identity. Therefore, all these morphological differences amongst populations were considered as intraspecific variation. Xiphinema hunaniense and X. brasiliense belong to X. radicicola-group. They are difficult to separate in morphology both possessing a relatively short body size, an anteriorly situated vulva and a simple posterior uterus lacking a “Z” organ or other ornamentation, but can be differentiated by sequence of 28S D2–D3 expansion region (Wu et al., 2007). In this study, a comparison of the ranges of the morphometrics of females from X. hunaniense and X. brasiliense showed that most characters are partialy overlapping except for a lower c’ value (1.0 – 1.3 vs 1.5 – 2.6) and a more posterior guide ring (109 – 120 vs 86 – 108 μm) of X. brasiliense (Table 1). However, analysis of molecular data (28S D2–D3 rDNA) of these two species indicated their identify being only 89 % – 90 % (110 – 112 nucleotide differences). Molecular phylogenetic analysis based on sequences of the 28S D2–D3 expansion region revealed that they are in separate clades (Fig. 4).
Xiphinema hunaniense was once considered as a junior synonym of X. radicicola (Loof et al., 1996), but it was re-established as a valid species by Robbins & Wang (1998) and Zheng & Brown (1999). Alignment of sequences of the 28S D2–D3 expansion region from X. hunaniense and a Vietnam population of X. radicicola indicated that they have 83 % identity with 153 nucleotide differences. Molecular phylogenetic analysis based on sequences of the 28S D2–D3 revealed that they are clearly different species (Fig. 4). Thus these three species are all valid species and can be differentiated by molecular data of 28S D2–D3 rDNA. Xiphinema brasiliense has been found in Brazil (Lordello, 1951), Guatemala, Ceylon and Nigeria (Cohn & Sher, 1972), the Ivory Coast and Australia (Luc, 1981), Peru (Alkemade & Loof, 1990), India (Loof et al., 2001), Venezuela (Cordero, 2003), Taiwan (Ni et al., 2003; Chen et al., 2004), China (Wu, 2007). Liu et al. (1995) identified a population from Sageretia theezans Brongn in Guangdong as X. brasiliense only based on morphology, but Song et al. (1998) considered this population as X. hunaniense by morphological observation compared with a population of X. hunaniense from bonsai in Shanghai. In this study, a comparison of the ranges of the morphometrics of females from S. theezans in Guangdong (Liu et al., 1995) and our population of X. brasiliense from Gleichenia linearis in Shenzhen, Guangdong revealed that almost all characters of both populations are very similar except for a more anteriorly-located guide ring from the S. theezans population (94 – 108 vs 109 – 120 μm) (Table 2). Sequence analysis of the 28S D2–D3 supported species identity of our population. Therefore, it is necessary to identify species of nematodes by combination of morphological and molecular data. So far, X. brasiliense has been reported from various hosts including Solanum tuberosum L., Litchi chinensis, Citrus sp. L., Mangifera indica L., Persea americana Mill., Musa sp. L., Saccharum officinarum L., Sorghum bicolor L., Andropogum bicornis L., Clidermia hirta L. D. Don., Prunus persica L., Euterpes edulis Mart., and Butia capitata (Mart.) Becc. (Alkemade & Loof, 1990; Cordero, 2003; Diaz-Silveira & Herrera, 1998; Lordello, 1951; Oliveira et al., 2003; Wu, 2007). Gleichenia linearis is a new host record for X. brasiliense.
Xiphinema americanum s.l. and X. hunaniense have been reported from China. Xiphinema americanum s.l. is reported from Jiangsu, Zhejiang, Hunan, Guangxi, Shandong, Hebei and Inner Mongolia, Sichuan, Yunnan (CABI, 2011; Wang & Wu, 1992; Xu et al., 1995). Xiphinema hunaniense is reported from Hunan, Zhejiang, Guangxi, Fujian, and Shanghai (Pan et al., 2000; Wang et al., 1996; Wang & Wu, 1992; Xu et al., 1995; Wu et al., 2007; Song et al., 1998). Our study added new records to the list. These two species are associated with various plants. Xiphinema hunaniense has been reported from Camellia japonica L., Citrus grandis (L.) Osbeck, Citrus sinensis (L.) Osbeck, Cycas revolute L., Euphoria longana Lam., Eriobotrya japonica Lindl., Vitis vinifera L., Hibiscus rosasinensis L., Litchi chinensis, Mangifera indica, Pyrus pyrifolia var. yokoyama, Pinus sp. L., Prunus sp. L., Buxus sinica L., Camellia sasanpua L., Ligustrum quihoui L., L. lucidum L. and Juniperus chinensis L. (Chen et al., 2004; Long et al., 2014; Wu et al., 2007; Zheng et al., 1999) and X. americanum s.l. from agricultural, horticultural and forest soils, including Agropyron cristatum Gaertn., Amygdalus persica L., Castanea mollissima Bl., Citrus aurantium L., Coffea arabica L., Crataegus sp. L., Cynodon dactylon Pers., Daucus carota L., Diospyros kaki Thunb., Eucalyptus tereticornis Sm., Fragaria sp. L., Ilex crenata Thunb., Juglans regia L., Ligustrum sp. L., Litchi chinensis, Malus sp. Mill., Persea americana, Podocarpus macrophyllus L., Pyrus sp. L., Rosa indica L., Urtica urens L., Vitis sp. L., Zea mays L. (Brodie et al., 1969; Cohn, 1969; Cohn & Mordechai, 1969; Cohn & Orion, 1970; Cho et al., 1991; Goodey et al., 1965; Griffin et al., 1996; Morton, 1987; Norton & Varon De Agudelo, 1984; Sakai et al., 2011; Siddiqui et al., 1973; Wang et al., 1992; Zhao et al., 2012). To our knowledge, this is the first report of X. hunaniense on B. orientale and G. linearis and X. americanum s.l. on A. mangium, A. confuse and B. orientale.
Acknowledgements
The authors would like to thank Mr. Zhicong Li and Mr. Haohui Li for assistance with soil sample collection. This study was supported by a grant from Shenzhen Residential and Environmental Committee, China (SZGX2012118F-SCZJ). The first author received a co-scholarship of China Scholarship Council and Guangdong Department of Education.