Figure 1
Expression of Wnt and Frizzled genes in mouse totipotent teratocarcinoma F9 embryonal cells. RNA was extracted from mouse F9 cells and then reverse-transcribed (RT) to the first strand cDNA. PCR amplification of the cDNA was conducted using specific primers for mouse Wnt1 through Wnt16, mouse Frizzled-1 through Frizzled-10 as well as for LRP5 and LRP6 (Tables 1, 2). The predicted sizes of the PCR products are listed in Tables 1 and 2. Data displayed are from one set of representative RT-PCR products of mouse F9 cells with primers specific for Wnts (A), Frizzleds (B), and LRP5/6 (C). R and RT in panel B indicate results of PCR performed on either the total RNA or the products of reverse transcription, respectively. Markers of DNA fragments (MK, bp) are provided and sizes labeled. In the case of appearance of multiple bands in panels A and B, each band of PCR product was purified and sequenced. * denoted the band corresponding to expected Wnt or Fz. Extraction of RNA were performed and subjected to RT-PCR using whole-cell preparations from at least three independent sources, each prepared on separate occasions.
Table 1
Primer sequences for RT-PCR analysis of mouse Wnt (mWnt) genes
| Gene | Accession No. | Sequence (5' to 3') | Amplicon (bp) |
| mWnt1 | NM_021279 | (F) ccgagaaacagcgttcatct (R) gcctcgttgttgtgaaggtt | 252 |
| mWnt2 | NM_023653 | (F) Atctcttcagctggcgttgt (R) agccagcatgtcctcagagt | 326 |
| mWnt2b | NM_009520 | (F) cacccggactgatcttgtct (R) tgtttctgcactccttgcac | 236 |
| mWnt3 | NM_009521 | (F) cgctcagctatgaacaagca (R) aaagttgggggagttctcgt | 303 |
| mWnt3a | NM_009522 | (F) cccaacttctgcgaacctaa (R) tctccgccctcaagtaagaa | 347 |
| mWnt4 | NM_009523 | (F) aacggaaccttgaggtgatg (R) ggacgtccacaaaggactgt | 345 |
| mWnt5a | NM_009524 | (F) ctggcaggactttctcaagg (R) ctctagcgtccacgaactcc | 388 |
| mWnt5b | NM_009525 | (F) gggaccgtttgaaggagaag (R) ctcttgaagcggtcatagcc | 259 |
| mWnt6 | NM_009526 | (F) tcagttccagttccgtttcc (R) ttgacttctcatccccgaag | 323 |
| mWnt7a | NM_009527 | (F) cgagagctaggctacgtgct (R) acagcacatgaggtcacagc | 264 |
| mWnt7b | NM_009528 | (F) tacctaagttccgcgaggtg (R) acgtgttgcacttgacgaag | 363 |
| mWnt8a | NM_009290 | (F) tgtcatggcatctcaggaag (R) gcggttgcagtagtcaggag | 240 |
| mWnt8b | NM_011720 | (F) gtggacttcgaagcgctaac (R) ttacacgtgcgtttcatggt | 316 |
| mWnt9a | NM_139298 | (F) tgctttcctctacgccatct (R) tatcaccttcacacccacga | 256 |
| mWnt9b | NM_011719 | (F) aggagacggccttcctgtat (R) gcacttgcaggttgttctca | 296 |
| mWnt10a | NM_009518 | (F) gcgctctgggtaaactgaag (R) cacacggttgttgtggagtc | 302 |
| mWnt10b | NM_011718 | (F) ggaagggtagtggtgagcaa (R) cacttccgcttcaggttttc | 298 |
| mWnt11 | NM_009519 | (F) gtgcggacaacctcagctac (R) gacaggtagcgggtcttgag | 259 |
| mWnt16 | NM_053116 | (F) ctgtgaaaccaccttgcaga (R) caggttttcacagcacagga | 261 |
Table 2
Primer sequences for RT-PCR analysis of mouse Frizzled (mFzd) and LRP genes
| Gene | Accession No. | Sequence (5' to 3') | Amplicon (bp) |
| mFz1 | NM_021457 | (F) caaggtttacgggctcatgt (R) tgaacagccggacaggaaaa | 178 |
| mFz2 | NM_020510 | (F) ccgacggctctatgttcttc (R) tagcagccggacagaaagat | 173 |
| mFz3 | NM_021458 | (F) tgggttggaagcaaaaagac (R) cctgctttgcttctttggtc | 239 |
| mFz4 | NM_008055 | (F) gccaatgtgcacagagaaga (R) aggtggtggagatgaagcag | 398 |
| mFz5 | NM_022721 | (F) ctgtggtctgtgctgtgctt (R) ggccatgccaaagaaataga | 264 |
| mFz6 | NM_008056 | (F) tctgtgcctctgcgtatttg (R) tctcccaggtgatcctgttc | 218 |
| mFz7 | NM_008057 | (F) gcttcctaggtgagcgtgac (R) aacccgacaggaagatgatg | 216 |
| mFz8 | NM_008058 | (F) ttacatgcccaaccagttca (R)cggttgtagtccatgcacag | 306 |
| mFz9 | NM_284144 | (F) agtttcctcctgaccggttt (R) ttttcggtagcacaggctct | 390 |
| mFz10 | NM_175284 | (F) agattcccatgtgcaaggac (R) agttggggtcgttcttgttg | 321 |
| mLRP5 | NM_008513 | (F) Aagaccctgcttgaggacaa (R) gagtgggatagccacatcgt | 402 |
| mLRP6 | NM_008514 | (F) Gagctcatcggtgacatgaa (R) gctcgaggactgtcaaggtc | 400 |
Figure 2
Expression of Wnt genes in human embryonic H7 stem cells and human mesenchymal cells. RNA was extracted from either human embryonic (H7) or mesenchymal (hM) cells and then subjected to reverse transcription to the first strand cDNA. PCR amplification of the cDNA was conducted using specific primers for human Wnt1 through Wnt16 (Table 3). The predicted size of the PCR products for each Wnt is listed in Table 3. The data displayed are from a representative PCR performed on the same whole-cell RNA and first subjected to RT. Markers of DNA fragments (MK, bp) are provided and the sizes labeled. Each separated band of PCR products was purified and subjected to DNA sequencing. Each band has been confirmed as expected gene products based upon DNA sequencing. * denoted a possible splicing form of corresponding genes. Extraction of RNA were performed and subjected to RT-PCR using whole-cell preparations from at least three independent sources, each prepared on separate occasions.
Figure 3
Expression of Frizzled and LRP5/6 genes in human embryonic H7 stem cells or human mesenchymal cells. RNA was extracted from either human embryonic (H7) or mesenchymal (hM) cells and then subjected to reverse transcription to the first strand cDNA. PCR amplification of the cDNA was conducted using specific primers for human Frizzled-1 through Frizzled-10 (A) or LRP5 versus LRP6 (B). The nucleotide sequence of each primer and predicted size of the PCR products for each Frizzled is listed in Table 4. The data displayed are from a representative PCR performed on the same whole-cell RNA and first subjected to RT. Markers of DNA fragments (MK, bp) are provided and the sizes labeled. Extraction of RNA were performed and subjected to RT-PCR using whole-cell preparations from at least three independent sources, each prepared on separate occasions.
Table 3
Primer sequences for RT-PCR analysis of human Wnt (hWnt) genes
| Gene | Accession No. | Sequence (5' to 3') | Amplicon (bp) |
| hWnt1 | NM_005430 | (F) gcgtctgatacgccaaaatc (R) ggattcgatggaaccttctg | 244 |
| hWnt2 | NM_003391 | (F) tagtcgggaatctgcctttg (R) ttcctttcctttgcatccac | 221 |
| hWnt2b | NM_004185 | (F) ctcatcagcaggggtagtcc (R) aaaacggacaccgtagtgga | 159 |
| hWnt3 | NM_030753 | (F) acgagaactcccccaacttt (R) gatgcagtggcatttttcct | 170 |
| hWnt3a | NM_033131 | (F) tgttgggccacagtattcct (R) atgagcgtgtcactgcaaag | 302 |
| hWnt4 | NM_030761 | (F) ccttcgtgtacgccatctct (R) gcctcattgttgtggaggtt | 250 |
| hWnt5a | NM_003392 | (F) ccacatgcagtacatcggag (R) cactctcgtaggagcccttg | 378 |
| hWnt5b | NM_032642 | (F) gtgcagagacccgagatgtt (R) caggctacgtctgccatctt | 550 |
| hWnt6 | NM_006522 | (F) ggttatggaccctaccagca (R) aatgtcctgttgcaggatgc | 208 |
| hWnt7a | NM_004625 | (F) agtacaacgaggccgttcac (R) gcacgtgttgcacttgacat | 326 |
| hWnt7b | NM_058238 | (F) aagctcggagcactgtcatc (R) ccctcggcttggttgtagta | 374 |
| hWnt8a | NM_058244 | (F) tggggaacctgtttatgctc (R) ccctcggcttggttgtagta | 456 |
| hWnt8b | NM_003393 | (F) ctggtccaaaggcttacctg (R) tgagtgctgcgtggacttc | 557 |
| hWnt9a | NM_003395 | (F) gacggtcaagcaaggatctg (R) tgctctcgcagttcttctca | 411 |
| hWnt9b | NM_003396 | (F) ctgcttgagtgccagtttca (R) cgagtcatagcgcagtttca | 477 |
| hWnt10a | NM_025216 | (F) aatgccaacaccaattcagg (R) caactcggttgttgtgaagc | 464 |
| hWnt10b | NM_003394 | (F) gcaagagtttcccccactct (R) gattgcggttgtgggtatc | 367 |
| hWnt11 | NM_004626 | (F) ttgcttgacctggagagagg (R) gacgagttccgagtccttca | 521 |
| hWnt16 | NM_007168 | (F) tgctccgatgatgtccagta (R) acctcctgcaacggacatag | 562 |
Table 4
Primer sequences for RT-PCR analysis of human Frizzled (hFz) and LRP genes
| Gene | Accession No. | Sequence (5' to 3') | Amplicon (bp) |
| hFz1 | NM_003505 | (F) gtgagccgaccaaggtgtat (R) cagccggacaagaagatgat | 184 |
| hFz2 | NM_001466 | (F) gcgtcttctccgtgctctac (R) ctgttggtgaggcgagtgta | 286 |
| hFz3 | NM_017412 | (F) tgagtgttcgaagctctatgg (R) atcacgcacatgcagaaaag | 229 |
| hFz4 | NM_012193 | (F) aacctcggctacaacgtgac (R) gttgtggtcgttctgtggtg | 303 |
| hFz5 | NM_003468 | (F) aacctcggctacaacgtgac (R) gttgtggtcgttctgtggtgc | 322 |
| hFz6 | NM_003506 | (F) attttggtgtccaaggcatc (R) tattgcaggctgtgctatcg | 311 |
| hFz7 | NM_003507 | (F) gtgcagtgttctcccgaact (R) gaacggtaaagagcgtcgag | 544 |
| hFz8 | NM_031866 | (F) tcttgtcgctcacatggttc (R) tgtagagcacggtgaacagg | 375 |
| hFz9 | NM_003508 | (F) cgctggtcttcctactgctc (R) agaagaccccgatcttgacc | 414 |
| hFz10 | NM_007197 | (F) gcggtgaagaccatcctg (R) gcacggtgtacagcacagag | 276 |
| hLRP5 | NM_002335 | (F) accggaaccacgtcacag (R) gggtggataggggtctgagt | 305 |
| hLRP6 | NM_002336 | (F) aggcacttacttccctgcaa (R) gggcacaggttctgaatcat | 274 |
Table 5
Expression of Wnt gene in mouse totipotent teratocarcinoma embryonic cell (F9), human embryonic stem cell (H7), and human mesenchymal cells (hM).
| gene\cell | F9 | H7 | hM |
| Wnt 1 | + | + | - |
| Wnt 2 | - | + | + |
| Wnt 2b | + | + | + |
| Wnt 3 | + | + | + |
| Wnt 3a | + | + | + |
| Wnt 4 | + | + | + |
| Wnt 5a | + | + | + |
| Wnt 5b | + | + | + |
| Wnt 6 | + | + | + |
| Wnt 7a | + | + | + |
| Wnt 7b | + | + | + |
| Wnt 8a | + | + | - |
| Wnt 8b | + | + | - |
| Wnt 9a | + | + | + |
| Wnt 9b | + | + | - |
| Wnt 10a | + | + | - |
| Wnt 10b | + | + | + |
| Wnt 11 | + | + | - |
| Wnt 16 | + | + | + |
RNA was extracted from F9, H7 and hM and reverse-transcribed to obtain first strand cDNA. Specific primers were used in PCR to amplify each Wnt cDNA. Amplified products were purified and confirmed by DNA sequencing.
Table 6
Expression of Frizzled and LRP genes in mouse totipotent teratocarcinoma embryonic cell (F9), human embryonic stem cell (H7), and human mesenchymal cells (hM).
| gene\cell | F9 | H7 | hM |
| Fz 1 | + | + | + |
| Fz 2 | + | + | + |
| Fz 3 | + | + | + |
| Fz 4 | + | + | + |
| Fz 5 | + | + | + |
| Fz 6 | + | + | + |
| Fz 7 | + | + | + |
| Fz 8 | + | - | - |
| Fz 9 | + | + | + |
| Fz 10 | + | + | + |
| LRP5 | + | + | + |
| LRP6 | + | + | + |
RNA was extracted from F9, H7 and hM and reverse-transcribed to obtain first strand cDNA. Specific primers were used in PCR to amplify each Wnt cDNA. Amplified products were purified and confirmed by DNA sequencing.