Table 1
Primer sequence for real-time RT-PCR analysis
| Gene | Genbank | Forward | Reverse |
|---|---|---|---|
| MT-2 | NM_008630 | CCGATCTCTCGTCGATCTTC | AGGAGCAGCAGCTTTTCTTG |
Figure 1
Diurnal variations of mRNA levels of the clock gene Bmal1 in adult female and male KM mouse livers and kidneys (n = 4/sex/time point). Values are means ± SEM. Circadian (t = 24 h) rhythms was confirmed by the cosine algorithm method (p < 0.05).
Figure 2
Diurnal variations of mRNA levels of the clock Dbp in adult female and male KM mouse livers and kidneys (n = 4/sex/time point). Values are means ± SEM. Statistically significant 24 h rhythms was confirmed by the cosine algorithm method (p < 0.05).
Figure 3
Diurnal variations of mRNA levels of MT-1 in adult female and male KM mouse livers and kidneys (n = 4/sex/time point). Values are means ± SEM. The rhythms was validated by the cosine algorithm method (p < 0.05).
Figure 4
Diurnal variations of mRNA levels of MT-2 in adult female and male KM mouse livers and kidneys (n = 4/sex/time point). Values are means ± SEM. Significant circadian rhythm was confirmed by the cosine algorithm method (p < 0.05).
Figure 5
Diurnal variations of MT-2 and Cry1 mRNA levels in adult female and male KM mouse blood (n = 4/sex/time point). Values are means ± SEM. Significant circadian rhythm for Cry1 expression in females was confirmed by the cosine algorithm method (p < 0.05).
Figure 6
Diurnal variations of hepatic MT protein in adult male KM mice. (A) was determined by the Cd/hemoglobin assay(n = 4/sex/time point). (B) was determined by western blot (n = 4/sex/time point). Values are means ± SEM. Significant circadian rhythm was confirmed by the cosine algorithm method (p < 0.05).
Figure 7
Sex differences in mRNAs levels of clock and MT at their peak in males and females (n = 4/sex/time point). Values are means ± SEM, and setting males as 100%. Significance was determined by Student’s t test (*p < 0.05 vs males).