Skip to main content
Have a personal or library account? Click to login
Differential roles of breakfast only (one meal per day) and a bigger breakfast with a small dinner (two meals per day) in mice fed a high-fat diet with regard to induced obesity and lipid metabolism Cover

Differential roles of breakfast only (one meal per day) and a bigger breakfast with a small dinner (two meals per day) in mice fed a high-fat diet with regard to induced obesity and lipid metabolism

Open Access
|May 2012

Figures & Tables

Figure 1

Body weight gain and quantity of adipose tissue.A: Experimental schedule. Eight-week-old mice were divided into three groups as follows: 3.6 g of high-fat chow at ZT12 as breakfast (one meal group); and 2.7 g of high-fat chow at ZT12 as breakfast and 0.9 g at ZT0 as dinner (two meals group), and a free-feeding (FF) group. White circle: one meal; black circle: two meals. B: Increase in body weight. Body weight at the start of restricted feeding is designated as 1. Restricted feeding starts at 0 (X-axis). Gray circle: FF; white circle: one meal; black circle: two meals. Data are presented as mean ± SEM values (FF, n = 16; one meal, n = 20; two meals, n = 19). # p < 0.05, ## p < 0.01 vs. FF, * p < 0.05, vs. one meal (Tukey-Kramer test). C: Visceral fat, subcutaneous fat and total body fat. Y-axis: (adipose tissue weight/body weight) × 100 (%). Gray column: FF; white column: one meal; black column: two meals. Data are presented as mean ± SEM values (FF, n = 16; one meal, n = 20; two meals, n = 19). # p < 0.05, ## p < 0.01 vs. FF, * p < 0.05, ** p < 0.01 vs. one meal (Tukey-Kramer test).

Table 1

Primer sequences of each gene

 Gene name Forward Reverse
Cpt1 GTGACTGGTGGGAGGAATACGAGCATCTCCATGGCGTAG
Table 2

Analysis of serum insulin, leptin, and adiponectin levels by one-way and two-way ANOVA

  FF 1meal 2meals FF vs. 1meal FF vs.2meals 1meal vs.2meals
AdiponectinF = 4.7, p < 0.05 F = 0.4, p > 0.05 F = 1.2, p > 0.05 F = 2.5, p > 0.05 F = 3.0, p < 0.05 F = 0.6, p > 0.05
Figure 2

Serum levels of insulin, leptin and adiponectin.A: Daily pattern of insulin level. B: Daily pattern of leptin level. C: Daily pattern of adiponectin level. Horizontal open and closed bars indicate light and dark periods, respectively. The number of mice at each time point was 4–6 for each group. Columns in the right panels show the average level throughout the day. Data are presented as mean ± SEM (FF, n = 16; one meal, n = 20; two meals, n = 19). Gray circle and column: FF; white circle and column: one meal; black circle and column: two meals. ## p < 0.01 vs. FF, ** p < 0.01 vs. one meal (Tukey-Kramer test).

Table 3

Analysis of liver and WAT clock gene expression by one-way and two-way ANOVA

  FF 1meal 2meals FF vs. 1meal FF vs.2meals 1meal vs.2meals
liver Per2F = 39.7, p < 0.001 F = 15.2, p < 0.001 F = 24.2, p < 0.001 F = 4.0, p < 0.05 F = 14.2, p < 0.001 F = 2.1, p > 0.05
Figure 3

Clock gene expression in visceral adipose (WAT) and liver tissues in mice with one meal or two meals.A, B: Daily pattern of Per2 and Bmal1 mRNA level in WAT, respectively. E, F: Daily pattern of Per2 and Bmal1 mRNA level in liver, respectively. The number of mice at each time point was 4–6 for each group. C, D, G, H: Columns show the average level of gene expression throughout the day. Data are presented as mean ± SEM values (FF, n = 16; one meal, n = 20; two meals, n = 19). Y-axis: the relative levels of each data set are normalized to the corresponding Gapdh mRNA levels. Gray circle and column: FF; white circle and column: one meal; black circle and column: two meals. ## p < 0.01, #p < 0.05 vs. FF, * p < 0.05, ** p < 0.01 vs. one meal (Tukey-Kramer test).

Table 4

Analysis of liver and WAT metabolism-related gene expression by one-way and two-way ANOVA

  FF 1meal 2meals FF vs. 1meal FF vs.2meals 1meal vs.2meals
liver Cpt1F = 4.5, p < 0.05 F = 4.0, p < 0.05 F = 2.9, p > 0.05 F = 2.5, p > 0.05 F = 1.1, p > 0.05 F = 2.4, p > 0.05
Figure 4

Metabolic related gene expression in (WAT and liver tissues in mice with one meal or two meals.A, B, C: Daily pattern of Srebp-1c, Fas, and Fabp1 mRNA level in WAT, respectively. G, H, I: Daily pattern of Srebp-1c, Fas, and Fabp1 mRNA level in liver, respectively. The number of mice at each time point was 4–6 for each group. D, E, F, J, K, L: Columns show the average level of gene expression throughout the day. Data are presented as mean ± SEM values (FF, n = 16; one meal, n = 20; two meals, n = 19). Y-axis: the relative levels of each data set are normalized to the corresponding Gapdh mRNA levels. Gray circle and column: FF; white circle and column: one meal; black circle and column: two meals. ## p < 0.01, #p < 0.05 vs. FF, * p < 0.05, ** p < 0.01 vs. one meal (Tukey-Kramer test).

Figure 5

β-oxidation related gene expression in WAT and liver tissues in mice with one meal or two meals.A, B, C: Daily pattern of Mtp, Pparα, and Cpt1 mRNA levels in WAT, respectively. G, H, I: Daily pattern of Mtp, Pparα, and Cpt1 mRNA level in liver, respectively. D, E, F, J, K, L: Columns show the average level of gene expression throughout the day. Data are presented as mean ± SEM values (FF, n = 16; one meal, n = 20; two meals, n = 19). Y-axis: the relative levels of each data set are normalized to the corresponding Gapdh mRNA levels. The number of mice at each time point was 4–6 for each group. Gray circle and column: FF; white circle and column: one meal; black circle and column: two meals. ## p < 0.01, #p < 0.05 vs. FF, * p < 0.05, ** p < 0.01 vs. one meal (Tukey-Kramer test).

Language: English
Published on: May 15, 2012
Published by: Ubiquity Press
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2012 Yuta Fuse, Akiko Hirao, Hiroaki Kuroda, Makiko Otsuka, Yu Tahara, Shigenobu Shibata, published by Ubiquity Press
This work is licensed under the Creative Commons Attribution 4.0 License.