Sri Lanka Veterinary Journal Feed

Pcr-Based Screening of Pathogenic Theileria Species in Goats in Ampara District, Sri Lanka

Mon, 05 Oct 2026 00:00:00 GMT

The goat industry plays an important role in Sri Lanka’s rural economy, with farms predominantly concentrated in the dry and intermediate zones. The industry’s popularity has increased over time due to low investment costs and high economic returns. Several parasitic diseases have been described in goats, including theileriosis, caused by pathogenic protozoa of the genus Theileria. A few cases of theileriosis have been reported from the Veterinary Surgeon’s Division, Ampara. Following a detailed investigation, Theileria luwenshuni was isolated from affected animals, indicating the possibility of infection among other animals in the herd. Therefore, the present study was designed and implemented to conduct molecular screening and identify risk factors associated with pathogenic Theileria species in goats in the Ampara and Uhana Veterinary Surgeon’s Divisions. A total of 125 whole blood samples were collected from randomly selected goats across the study area. Demographic information, including sex, age and degree of tick infestation, was also recorded. DNA was extracted from the blood samples, and PCR was performed using specific primers for Theileria lestoquardi, Theileria uilenbergi and Theileria luwenshuni. The results revealed a 22.4% prevalence of Theileria luwenshuni in the study, while the other two parasites were absent. Moreover, sex and tick infestation were identified as potential risk factors, with a statistically significant association with disease prevalence (p < 0.05). Three samples identified as positive for Theileria luwenshuni were subjected to sequencing and deposited under accession numbers PZ306778, PZ306779 and PZ306780 in the GenBank database. BLAST analysis of the 18S rRNA gene sequences obtained in this study revealed sequence similarities ranging from 98.08% to 100% with reference sequences from different animal hosts and geographical locations in the NCBI GenBank database. Most notably, the present isolate showed a 100% identity score with the Theileria luwenshuni isolate from Jaffna sheep, indicating a potential risk of local transmission of the pathogen between host species.

Rising from the Floods of 2025: Reflections on the process at the Faculty of Veterinary Medicine and Animal Science, University of Peradeniya

Mon, 05 Oct 2026 00:00:00 GMT

No abstract available

Evaluation of the Efficiency of Different Oestrous Syncharonisation Protocols Used in Dairy Goats: A Pilot Study in Sri Lanka

Mon, 05 Oct 2026 00:00:00 GMT

Hormonal control of ovulation improves breeding efficiency by shortening the breeding period and enabling fixed-time artificial insemination (FTAI). In goats, oestrous synchronisation is essential for successful AI. Although Controlled Internal Drug Release (CIDR)-based protocols are widely used, they require the concurrent administration of pregnant mare serum gonadotrophin (PMSG), increasing the overall cost of treatment. This pilot study evaluated the efficacy and economic feasibility of five oestrous synchronisation protocols for oestrus induction in dairy goats, to identify practical alternatives to conventional CIDR-based methods under Sri Lankan conditions. A total of 52 healthy, non-pregnant Saanen does, with a body condition score of 2.5 - 3.0 were randomly assigned to five FTAI protocols: a) CIDR-Long (n=10), (CIDR for 18 days); b) CIDR-Short (n= 10), (CIDR for 10 days); both groups received 400 IU PMSG at device removal, and FTAI 48-56 hours later; c) 2PG-GH (n=10): PGF2ᾳ on Day 0 and 7, PMSG on Day 7, GnRH on Day 9, and FTAI 48-56 hours later; d) Ovsynch (n=7): GnRH on Day 0, PGF2ᾳ on Day 7, GnRH on Day 9, and FTAI 16-20 hours later; e) NCsynch (n=11): PGF2ᾳ on Day 0 and 14, GnRH on Day 7, FTAI on Day 17. Animals were assessed for six behavioural and physical signs of oestrus at insemination, and pregnancy was confirmed by ultrasonography 45 days after AI. Oestrus intensity, ranked from highest to lowest, was CIDR-Short (85.5%), NCsynch (82.4%), CIDR-Long (81.2%), Ovsynch (67.3%), and 2PG-GH (18.8%). Pregnancy rates were 50.0%, 40.0%, 10.0%, 42.8%, and 63.6% for the CIDR-Long, CIDR-Short, 2PG-GH, Ovsynch, and NCsynch groups, respectively. Although differences among protocols were not statistically significant (p > 0.05), Ovsynch and NCsynch achieved pregnancy rates of 42.8% and 63.6%, respectively, comparable to the CIDR-Long protocol. These hormone-only protocols were approximately 66.7% more cost-effective than CIDR-based treatments and were associated with fewer vaginal reactions and infections, thereby reducing the potential need for antimicrobial therapy. Larger-scale studies are warranted to confirm their efficacy and potential to improve reproductive performance while reducing the costs and health risks associated with intravaginal progesterone devices.

Occurrence of Canine Demodicosis in Selected Veterinary Hospitals in Kalutara District, Sri Lanka

Mon, 05 Oct 2026 00:00:00 GMT

Canine demodicosis, commonly known as demodectic mange, is a dermatological condition caused by mites of the genus Demodex. Dogs are particularly susceptible to this ectoparasitic infestation, which can present as localised or generalised disease, ranging from mild alopecia to severe ulcerative lesions. Despite its global distribution, published data on demodicosis in Sri Lanka remain limited. This study aimed to determine the occurrence of Demodex infection in pet dogs presented to selected veterinary hospitals in the Kalutara District. A cross-sectional survey was conducted using convenience sampling, and 100 dogs presenting with dermatological lesions were examined. Deep skin scrapings were collected, processed with potassium hydroxide, and microscopically examined to identify mites. Thereafter, morphometric measurements were recorded to differentiate species. Results revealed Demodex mites in 7 out of 100 samples, indicating an occurrence of 7%. Morphometric data showed that the specimens (mean body length 108.9 µm; gnathosoma 11.7 µm; podosoma 31.8 µm; opisthosoma 60.6 µm) were smaller than D. canis (156–269 µm) and excluded the larger D. injai (250–300 µm), aligning most closely with D. cornei (130–170 µm). However, definitive species identification requires molecular confirmation. Statistical analysis of host and environmental factors, including age, breed, sex, coat type, hygiene practices and diet, showed no significant associations with demodicosis (p > 0.05). These findings suggest that canine demodicosis occurs at a relatively low level in the Kalutara District and that conventional morphological methods alone are insufficient for accurate species differentiation. The study highlights the need to incorporate molecular diagnostic tools, including PCR and DNA sequencing, to achieve accurate species identification. It further emphasises the importance of conducting a larger-scale investigation to clarify the epidemiology and genetic diversity of Demodex infections in Sri Lanka, which would be a critical step towards developing effective treatment and preventive strategies.

Presumptive Diagnosis of Uveodermatological Syndrome in a 3-Year-Old Labrador Retriever

Mon, 05 Oct 2026 00:00:00 GMT

Uveodermatological syndrome (UDS) is a rare immune-mediated disorder in dogs characterised by concurrent ocular inflammation and progressive depigmentation of the skin and hair, with a strong breed predisposition. This case report describes UDS in a 3-year old female Labrador Retriever, a breed in which the condition is rarely documented. The dog presented with progressive vision impairment, severe ocular inflammation, and marked depigmentation of the nasal planum, lips, periocular regions, and trunk. Ophthalmic examination revealed immune-mediated keratitis and uveitis, while dermatological evaluation confirmed progressive depigmentation. Common infectious and parasitic skin diseases were excluded. Haematological evaluation identified concurrent Babesia gibsoni infection, which was treated prior to initiation of immunosuppressive therapy. Management with prednisolone and azathioprine resulted in marked clinical improvement of both ocular and dermatological lesions over two months. This case highlights the importance of considering UDS as a differential diagnosis in dogs with concurrent ocular and pigmentary abnormalities, even in non-predisposed breeds.

Declining Interest among Veterinary Graduates in Production Animal, Wildlife, and State Veterinary Services in Sri Lanka: Possible Causes and the Way Forward

Wed, 31 Dec 2025 00:00:00 GMT

No abstract available

Surgical Management of Cystic Blood Clot Consequent to Flutd and Frequent Urethral Catheterization in a Persian Cat

Wed, 31 Dec 2025 00:00:00 GMT

A young Persian tom cat was presented to the college clinic with a history of haematuria, stranguria, pollakiuria, anuria, dehydration, and anorexia for the last two days. The urinary bladder was repeatedly catheterised by a local veterinarian to treat feline lower urinary tract disease over two weeks period. On palpation, the abdomen felt tensed with a moderately distended urinary bladder. Urethral catheterisation and percutaneous cystocentesis proved futile. Abdominal survey radiography revealed moderately distended bladder without calculi and bilateral mild nephromegaly. Abdominal ultrasonography revealed thickened bladder wall, a large hyperechogenic structure occupying most of the bladder lumen suspected of blood clot or bladder wall tumour. Therefore, an emergency laparo-cystotomy was performed as per standard procedure, and a large blood clot was removed, followed by placement of a catheter. With optimum post operative care and management, the cat recovered uneventfully.

Point Seroprevalence of Chicken Anaemia Virus and Infectious Laryngotracheitis Virus in Village and Commercial Poultry Systems in Selected Areas of Central and North Western Provinces of Sri Lanka

Wed, 31 Dec 2025 00:00:00 GMT

The poultry industry in Sri Lanka plays a crucial role in economic development and nutritional security. This study aimed to evaluate point seroprevalence and risk factors of chicken anaemia virus (CAV) and infectious laryngotracheitis virus (ILTV) in village chickens within the Central Province, and also assess the point seroprevalence of ILTV in commercial layers from the Central and North Western Provinces. A cross-sectional survey and serological assessment were conducted at village chicken farms in the Central Province, and 48 blood samples were collected for antibody detection. Additionally, 311 blood samples from commercial layer flocks in Central and North Western Provinces were tested for ILTV seroprevalence. Chi-square tests were performed to identify associations between antibody prevalence and risk factors. Semi-intensive rearing was predominant (75%), with only 18.75% of farmers vaccinating (for Newcastle disease) their flocks and 37.50% practicing deworming. Nutritional supplementation varied, 50% providing calcium and 62.50% providing vitamin supplements. Despite 68.75% of farmers consulting veterinarians, significant health challenges persisted. Serological analysis indicated a high prevalence of CAV (87.50%) and ILTV (66.67%) in village chickens. CAV seroprevalence was significantly associated with flock size (P = 0.04) and veterinary consultation (P = 0.05). Seroprevalence of ILTV in village chickens showed no significant associations with risk factors. In contrast, ILTV seroprevalence in commercial poultry was markedly lower, with the prevalence rates of 13.26% in the Central Province and 5.63% in the North Western Province. The study highlights the multifaceted challenges in village poultry farming, including high disease prevalence, limited vaccination coverage, and nutritional deficiencies, and suggests that poultry farming can be strengthened by addressing these gaps.

Turpentine-Induced Acute Dermatitis in Rabbits: Acute Phase Protein Responses and Modulation by Topical Corticosteroid and Allium Cepa

Wed, 31 Dec 2025 00:00:00 GMT

Acute inflammatory skin conditions are commonly encountered in veterinary practice and are characterised by complex clinical, haematological, and biochemical responses that reflect underlying tissue injury and systemic acute phase reactions. This study evaluated the acute phase response, haematological alterations, and therapeutic modulation of turpentine-induced dermatitis in rabbits using topical hydrocortisone and Allium cepa (onion) juice. Twenty healthy adult New Zealand White rabbits were randomly assigned to four groups: control, turpentine-induced untreated, turpentine-induced treated with topical hydrocortisone, and turpentine-induced treated with onion juice. Dermatitis was induced by subcutaneous injection of 0.5 mL turpentine oil, and treatments were applied topically for three consecutive days beginning 12 hours post-induction. Clinical severity was assessed using a modified Draize scoring system, while haematological indices and serum biochemical parameters, including acute phase proteins, were evaluated at 0, 24, 48, and 72 hours. Turpentine administration induced marked heterophilic leukocytosis, elevated serum C-reactive protein and haptoglobin concentrations, and a reduction in albumin levels (P < 0.05). These changes were significantly attenuated by topical hydrocortisone, while onion juice produced moderate but consistent anti-inflammatory effects. The study supports the use of turpentine-induced dermatitis as a reproducible rabbit model for acute phase reactions and suggests that Allium cepa possesses adjunct antiinflammatory potential in veterinary dermatological management.

Investigating the Prevalence of Penaeus Monodon Densovirus Infection in Selected Shrimp Farms in Chilaw, Sri Lanka

Wed, 31 Dec 2025 00:00:00 GMT

Penaeus monodon Densovirus (PmDNV) infects the hepatopancreas of penaeid shrimp and causes an asymptomatic disease. Heavy infections cause stunted growth, leading to a decline in farm production. While PmDNV is widely distributed worldwide, there is no record of its prevalence in Sri Lanka. This study aimed to detect PmDNV in Penaeus monodon in Chilaw region of Sri Lanka. Forty (n=40) shrimp samples, aged 94-105 days, were collected from four selected farms (A, B, C and D) in Chilaw. The hepatopancreas of shrimp was isolated, and separate sections were preserved in Davidson’s fixative solution for histopathology and in 70% ethanol for DNA extraction. Fixed tissue samples were stained with Hematoxylin and Eosin (H&E), and infected hepatopancreas revealed hepatopancreatic cell necrosis and intranuclear inclusion bodies. DNA extraction was done according to the protocol of the Wizard Genomic DNA purification kit, and PCR was carried out using forward (5’AATCTGCAGGGTACGGAAAAAAC3’) and reverse (5’TGTGGAACCATCTCAAATGCC 3’) primers. The study found that 60% (24/40) of the shrimp were infected with PmDNV, and 27.5% of the samples were negative for the virus. From the studied samples, 12.5% of the samples did not show any bands in PCR. The severity of infection was assessed using band intensity, which revealed that 20% of samples were severely infected and that the majority (37.5%) were moderately infected. No significant difference was observed in the mean body weight and total length of infected and non-infected shrimps. Shrimp growth was not affected due to the moderate level of PmDNV infection.

Clinical Presentation, Diagnosis, Treatment and Treatment Outcome of Salivary Mucoceles in Dogs: A Case Series

Mon, 22 Dec 2025 00:00:00 GMT

A salivary mucocele is an accumulation of saliva in tissue spaces consequent to a leak of a damaged salivary gland or duct. This article describes the clinical presentation, diagnosis, treatment and treatment outcome of twenty one cases of salivary mucocele presented to the Veterinary Teaching Hospital, University of Peradeniya. The age of the dogs ranged from two to ten years; the breeds included both local and crosses of imported breeds. The diagnoses of salivary mucocele in all cases were made on clinical presentation and confirmed by fine needle aspiration cytology (FNAC). All cytological smears displayed windrowing and contained increased numbers of neutrophils, haemosiderin-laden macrophages, haematoidin crystals and bacteria. The causes for salivary mucocele were identified as trauma and inflammation, salivary adenocarcinoma and idiopathic. All dogs were treated surgically under general anaesthesia; surgical drainage, with removal of affected salivary gland and surgical drainage with removal of salivary carcinoma. In addition to surgical intervention, the dogs were prescribed with antibiotics, anti-inflammatory drugs and an Elizabethan collar was applied to prevent self-trauma. The treatment outcome was excellent in all dogs except one dog which had a salivary gland adenocarcinoma that succumbed a few weeks following surgery, despite supportive management.

Case Report on Pcr-Based Diagnosis of Caprine Theileriosis Caused by Theileria luwenshuni in the Veterinary Surgeon’s Division in Ampara, Ampara District, Sri Lanka

Mon, 22 Dec 2025 00:00:00 GMT

Theileriosis is a tick-borne disease of small ruminants that causes substantial economic losses in tropical and subtropical regions of Asia, Europe, Africa, and the Middle East. This case report describes the diagnosis and treatment of theileriosis in a goat herd in Sri Lanka. The outbreak occurred in a herd of 42 goats located in Ambagahawella Grama Niladhari Division within the Ampara Veterinary Surgeon’s Range, Ampara District. The herd experienced seven deaths over a period of 2–3 weeks, preceded by anorexia, lethargy, and diarrhoea. Clinical examination of affected animals revealed pale conjunctivae, pyrexia, superficial lymphadenopathy, a dull hair coat, and severe tick infestation. Differential diagnoses included gastrointestinal parasitism and haemoparasitism. Faecal examinations of four clinically affected goats and six apparently healthy animals were negative for gastrointestinal parasites. However, microscopic evaluation of Leishman-stained thin blood smears revealed intra-erythrocytic stages consistent with Theileria spp. Whole blood samples were submitted to the Division of Parasitology, Veterinary Research Institute, Peradeniya, for molecular confirmation. PCR testing confirmed the presence of the pathogenic species Theileria luwenshuni, while T. uilenbergi and T. lestoquardi were not detected. Infected goats were treated with an anti-protozoal and an antibiotic with supportive therapy. Three of the four clinically affected goats responded to treatment and recovered, whereas one severely affected animal succumbed to the infection. This report highlights the emergence of T. luwenshuni infection in goats in Sri Lanka and emphasises the importance of early diagnosis, prompt treatment, and tick control for effective disease management.

Standing by Our Values - Ethics in Companion Animal Practice

Mon, 22 Dec 2025 00:00:00 GMT

No abstract available

Assessment of Total Bacterial Count in Milk Collection Chain in Different Climatic Zones of Sri Lanka

Mon, 22 Dec 2025 00:00:00 GMT

Cow milk is initially contaminated on the inner surface of the teat canal. Microbes from teat surfaces, milkers’ hands, equipment, poor hygiene and unhygienic environments contribute to raw milk contamination on farms and along the milk collection chain, leading to high bacterial counts that compromise milk quality. Total Bacterial Count (TBC) is a key indicator of raw milk quality, relevant to processors, consumers, and public health decision making. This study aimed to assess TBC along the milk collection chain, including farms, milk collecting points (MCP), milk chilling centres (MCC), and a milk processing plant (MPP) across different climatic zones in Sri Lanka from January to December 2024. A total of 353 raw milk samples were collected from farm cans, 40 L cans, chilling tanks, bowsers, and storage tanks, and tested by Total Plate Count (TPC). Samples included 93 (farm), 150 (MCP), 46 (MCC), and 64 (MPP). Median TBC values were 4.40×10⁶, 4.80×10⁷, 9.35×10⁷, and 6.00×10⁸ cfu/ml, respectively, while mean values were 2.11×10⁸, 3.79×10⁸, 6.11×10⁸, and 1.27×10⁹ cfu/ml. TBC differed significantly among collection points (p<0.05), with Tukey’s HSD test identifying milk at the MPP as most contaminated. A substantial increase was observed from MCP to MPP. No statistically significant relationship was found between TBC and milk temperature, likely due to fluctuations during transport. Titratable acidity showed a weak, non-significant positive correlation with TBC. This study demonstrates progressive bacterial contamination along the collection chain, with the highest levels at the processing plant. Adoption of good hygienic practices at farm and collection levels is essential to ensure milk safety, improve product quality, and protect public health.

Indirect Association of Monsoon Rains with the Patterns of Dog-Mediated Rabies in Sri Lanka

Mon, 22 Dec 2025 00:00:00 GMT

In many rabies endemic countries including Sri Lanka, dog populations are the main rabies reservoir and the main source of human infection. Understanding the ecology and spatiotemporal determinants of dog populations could inform targeted dog population control and rabies vaccination campaigns. Studies from India have postulated a positive association between monsoon rains and dog mating frequency, i.e., rainy season mating followed by a peak of births in the subsequent dry season, leading to an increase in the unvaccinated dog population. To test the hypothesis (positive association between rainfall patterns and reported rabies cases) in Sri Lanka, spatial and temporal patterns of dog and human rabies cases from 2004 through 2021 were analysed and compared with rainfall patterns in relation to Sri Lanka’s three climate zones: wet, intermediate, and dry. Rabies cases were frequent in the highly populated south-west of the country, particularly in the wet zone. The study reveals an association between dog rabies cases and rainfall, with a notable increase in cases during the dry season across all three zones based on the Mann-Whitney U test. Hence, this suggests a seasonal variation in dog rabies incidence, potentially linked to rainy season mating followed by a peak of births in the subsequent dry season, among other potential factors. Hence, this supports the hypothesis of a potential rainfall-driven rise in the dog population. While further investigation is essential, this potential association of rainfall and fluctuations of dog populations could be considered in planning risk-based vaccination programmes, including spay-neuter programs for adult dogs (>1 year old), pre-rainy season vaccination and targeted vaccination of <1 year old pups soon after the end of the rainy season.

Clinical Presentation, Diagnosis, and Treatment of Leptospirosis in Four Owned Dogs from Sri Lanka

Tue, 31 Dec 2024 00:00:00 GMT

Leptospirosis is a zoonotic disease of global importance. This clinical communication reports the clinical presentation, diagnosis, treatment, and outcomes of leptospirosis in four owned dogs presented to the Veterinary Teaching Hospital, University of Peradeniya, within a period of four months. Clinical signs included anorexia, lethargy, and depression, with abdominal and lumbar pain on palpation. Only one dog had been properly vaccinated and dewormed. Common haematological and laboratory findings included anaemia, thrombocytopenia and elevated blood urea nitrogen (BUN). Diagnosis was confirmed using the microscopic agglutination test (MAT) in two dogs and nested polymerase chain reaction (PCR) targeting the flaB gene in the other two. Initial therapy consisted of fluid administration and antibiotics. Despite treatments, three dogs died within two to seven days, while one dog survived.

Impact of Administering Polyphenol-Rich Sugarcane Extract through Drinking Water on the Growth Performance and Meat Quality of Broiler Chickens

Tue, 31 Dec 2024 00:00:00 GMT

There is a growing interest in the broiler industry to explore innovative approaches that enhance productivity while maintaining optimum animal health and welfare. The current study focused on evaluating the effect of a polyphenol-rich sugarcane extract (PRSE) administered via drinking water on growth performance and meat quality of broiler chickens. Four experimental groups of Cobb 500 broilers (496) were housed in litter floor pens, viz., no PRSE (Control), 0.05% PRSE (Treatment-1), 0.25% PRSE (Treatment-2) from Day 0 to 35, and a transition dose of 0.25% (Day 0 to 17) reduced to 0.05% PRSE (Day 18 to 35) (Treatment-3). Treatments were prepared by adding the respective levels of PRSE to drinking water and supplying it for the specified periods. Each treatment was randomly assigned to two pens in each room. Each of the two rooms (blocks) was portioned into eight pens (31 birds/pen). Birds were fed commercial starter (Day 0 to 17) and finisher (Day 18 to 37) diets according to Cobb 500 broiler performance objectives, and water was given ad libitum. Feed intake, water intake, and mortality were recorded daily. Body weight gain and feed-to-gain ratio were evaluated on Days 11, 22, and 35 on a pen basis, and the birds selected for meat quality were euthanised on Day 38. Data were analysed using one-way ANOVA for a randomised complete block design. The supplementation of PRSE via drinking water did not affect broiler performance. Both 0.05 and 0.25% PRSE were found to reduce levels of Thiobarbituric Acid Reactive Substances (TBARS) in meat on Day 1 post-processing compared to the control by 99.8% and 96.0%, respectively. These concentrations increased the water holding capacity of meat on Day 7 when compared with the other groups. Birds receiving 0.25% and the transition dose of PRSE reduced meat colour luminosity on Day 7 as compared with other treatments. The consistent provision of 0.05 and 0.25% PRSE treatments resulted in enhanced broiler meat quality, although it did not impact broiler performance.

Molecular and Histopathological Study on Circulating Fowl Adenovirus Serotypes Causing Inclusion Body Hepatitis (Ibh) in Broiler Chickens in Sri Lanka

Tue, 31 Dec 2024 00:00:00 GMT

Inclusion Body Hepatitis (IBH) is an emerging acute viral disease in Sri Lanka caused by Fowl Adenoviruses (FAdVs) of the genus Aviadenovirus, family Adenoviridae. It primarily affects broilers aged 3–7 weeks, leading to liver damage and significant economic losses. Histopathological diagnosis of IBH is based on the presence of pathognomonic intranuclear basophilic inclusion bodies in degenerating hepatocytes. Molecular diagnosis of IBH involves the detection of the hexon gene of the FAdV using conventional PCR. The serotyping, based on the hexon gene L1 loop variable region, is important for developing effective vaccination strategies. This study aimed to identify circulating FAdV serotypes responsible for IBH in broilers in the Western, North Western, and Central provinces of Sri Lanka. A total of 76 dead broilers were collected/ received; Western (n = 23), North Western (n = 38), and Central (n = 15). Clinical history, vaccination data, and performance records were documented. The liver was the primary organ examined. Gross and histopathological evaluations were performed, and histopathological confirmation of IBH was based on intranuclear basophilic inclusion body detection. The gross lesions observed in all the examined livers had hepatomegaly, petechial haemorrhages and multifocalcoalescing necrotic patches. PCR was conducted on histopathologically confirmed IBH-positive samples (n = 28/76), of which 19 were PCR-positive (n = 19/28). Three PCR-positive samples from each province were selected for hexon gene sequencing using the Sanger method. Sequencing revealed serotype FAdV-8b in both the North Western and Central provinces and FAdV-11 only in the North Western province. No sequence data could be obtained from the Western province. These findings highlight the presence of different FAdV serotypes contributing to IBH in Sri Lanka and emphasise the need for region-specific surveillance and vaccination strategies.

Clinical Application and Outcome of Sub-Dermal Plexus Skin Flaps, Axial Pattern Flaps and a Skin Graft to Repair Extensive Cutaneous Defects In Dogs and Cats: 22 Cases

Tue, 31 Dec 2024 00:00:00 GMT

Skin flaps and grafts are widely used in veterinary practice to achieve closure of skin defects where primary wound closure is not possible. They can be used when addressing large cutaneous defects secondary to traumatic injury or following tumour resection. The objective of the study was to retrospectively evaluate the clinical indications, complications and outcomes associated with skin flaps and a graft in animals that underwent extensive cutaneous defect restoration. Data was collected from the medical records of 22 animals (12 dogs and 10 cats), which included 16 Subdermal Plexus Skin Flaps (SPSF), 5 Axial Pattern Flaps (APF) and one free skin graft. The outcome of skin reconstruction was subjectively evaluated based on the comparison of the surviving skin postoperatively to the original skin transposition. There were minor or moderate complications observed in SPSFs. In the five animals with APFs, one animal had moderate complications, while in one case, the flap completely failed due to occlusion of the blood supply. The full-thickness skin graft of the dog’s distal forelimb healed with complete graft uptake. All wound complications were managed conservatively. A higher proportion of extensive wounds observed in cats (75%) were in intact males due to trauma. In most of the dogs (83.3%), wounds were found following tumour resection. Twenty one out of the 22 animals recovered well postoperatively. Results suggested that large cutaneous defects can be repaired with excellent cosmetic and functional outcomes using skin flaps and grafts. Although postoperative complications are expected, standard wound management techniques can resolve them. Careful planning, meticulous surgical procedures and postoperative management are key for a successful outcome.

Temporal Pattern of Suspected Cerebrospinal Nematodiasis in Goats in Kandy District: A Retrospective Study Using Case Records of the Farm Animal Veterinary Teaching Hospital

Tue, 31 Dec 2024 00:00:00 GMT

Cerebrospinal nematodiasis (CSN) is a neuropathological disease in goats caused by migration of third-stage larvae of Setaria spp., which is transmitted by mosquitoes. It often leads to lifelong neurological complications, productivity losses, and culling recommendations. Understanding its regional epidemiology is essential for developing effective prevention and control strategies. This retrospective descriptive study analysed the temporal patterns of CSN occurrence in the Kandy district using clinical records from 4,524 goats presented to the Farm Animal Veterinary Teaching Hospital, University of Peradeniya, from 2016 to 2023. The overall prevalence of suspected CSN cases was low (5.0%) among study goats. However, a distinct temporal variation in CSN prevalence was observed, with peak disease occurrence between February and April, reaching its highest in March (13.6±6.4%). This period coincided with the region’s convectional rainfall episodes, suggesting that optimal rainfall conditions may have contributed to increased CSN occurrence. A decline in CSN prevalence was observed from May to September, corresponding with reduced rainfall. Additionally, a substantial drop in cases from April to May and again from September to November aligned with periods of higherthan- average rainfall, which may have disrupted mosquito breeding. These findings suggest that rainfall patterns significantly influence the temporal distribution of CSN, likely by affecting mosquito populations, the intermediate hosts of Setaria digitata. The findings emphasise the need for targeted disease prevention strategies, such as implementing strategic deworming protocols before the peak disease period and enhancing farmer awareness of mosquito control measures to mitigate CSN risks in the study region.